Skip to main content
Public Sessions
 

Sessions allow users to save snapshots of the Genome Browser and its current configuration, including displayed tracks, position, and custom track data. The Public Sessions tool allows users to easily share those sessions that they deem interesting with the rest of the world's researchers. You can add your own sessions to this list by checking the appropriate box on the Session Management page.

See the Sessions User's Guide for more information.

Sort by:

Screenshot Session Properties Creation Date Use Count
Description: primates
Author: mariahgiz07
Session Name: hg38 & primates
Genome Assembly: hg38
Creation Date: 2026-09-17
Views: 3 		1789632000 3
Description: added primates to show fusion and distant correlation
Author: IsabelleMcShane
Session Name: hg38Human&monkey(IM)
Genome Assembly: hg38
Creation Date: 2026-09-17
Views: 3 		1789632000 3
Description: hg38 fig. 2
Author: TLienard30
Session Name: hg38 Figure 2
Genome Assembly: hg38
Creation Date: 2026-09-17
Views: 4 		1789632000 4
Description: Figure 1
Author: jasmine_peou
Session Name: hg38 and chimp
Genome Assembly: hg38
Creation Date: 2026-09-17
Views: 5 		1789632000 5
Description: Figure 2
Author: jasmine_peou
Session Name: hg38 and 6 other primates JP
Genome Assembly: hg38
Creation Date: 2026-09-17
Views: 5 		1789632000 5
Description: hg38 ch2 fig. 2
Author: echen971
Session Name: hg38 ch2 fig. 2
Genome Assembly: hg38
Creation Date: 2026-09-17
Views: 5 		1789632000 5
Description: primates
Author: Desideem
Session Name: hg38 primates ED
Genome Assembly: hg38
Creation Date: 2026-09-17
Views: 3 		1789632000 3
Description: Bonobos, Gorillas, and Orangutans also have similar fusion events on chromosome 2 as humans do, while Proboscis monkeys and Golden Snub-nosed monkeys do not.
Author: getzge
Session Name: hg38 ch2 vs diff primates
Genome Assembly: hg38
Creation Date: 2026-09-17
Views: 9 		1789632000 9
Description: Ridley 7 Monkey Genomes
Author: cox2aa
Session Name: Ridley 7 Monkey Genomes
Genome Assembly: hg38
Creation Date: 2026-09-17
Views: 5 		1789632000 5
Description: Primates
Author: simonefortier
Session Name: hg38 - Primates
Genome Assembly: hg38
Creation Date: 2026-09-17
Views: 4 		1789632000 4
Description: human/chimp/other chr2 comparison
Author: scarpara
Session Name: hg38 chr2 Figure 2 RS
Genome Assembly: hg38
Creation Date: 2026-09-17
Views: 5 		1789632000 5
Description: Level 1 displays Chromosome 2 in humans. The darker green on the left side matches up with chromosome 2 in chimps, and the lighter green on the right has an unknown origin. This displays that a fusion event occurred to create human chromosome 2.
Author: getzge
Session Name: hg38 chr2 vs chimp
Genome Assembly: hg38
Creation Date: 2026-09-17
Views: 7 		1789632000 7
Description: 481 bio acitivty part 1 sarah neun
Author: sarahneun
Session Name: hg38browseractivty2smn
Genome Assembly: hg38
Creation Date: 2026-09-17
Views: 6 		1789632000 6
Description: Ridley Chromosome Fusion
Author: cox2aa
Session Name: Ridley Chromosome Fusion
Genome Assembly: hg38
Creation Date: 2026-09-17
Views: 4 		1789632000 4
Description: hg38 chr2 fig. 1
Author: echen971
Session Name: hg38 chr2 fig.1
Genome Assembly: hg38
Creation Date: 2026-09-17
Views: 6 		1789632000 6
Description: compare
Author: umangarupa
Session Name: hg38 chr2 compared to other primates UR
Genome Assembly: hg38
Creation Date: 2026-09-17
Views: 4 		1789632000 4
Description: human/chimp chr2
Author: scarpara
Session Name: hg38 chr2 Figure 1 RS
Genome Assembly: hg38
Creation Date: 2026-09-17
Views: 7 		1789632000 7
Description: 481 chimp gene
Author: MJ1234
Session Name: chimp: mj
Genome Assembly: hg38
Creation Date: 2026-09-17
Views: 4 		1789632000 4
Description: bio 481 part 2 assignment sarah neun
Author: sarahneun
Session Name: hg38browseractivitypt2smn
Genome Assembly: hg38
Creation Date: 2026-09-17
Views: 6 		1789632000 6
Description: highlighted of fusion
Author: IsabelleMcShane
Session Name: UCSC GB(IM)
Genome Assembly: hg38
Creation Date: 2026-09-17
Views: 5 		1789632000 5
Description: chr2 with chimps
Author: Feldmakl
Session Name: KatF chr2
Genome Assembly: hg38
Creation Date: 2026-09-17
Views: 6 		1789632000 6
Description: 481L
Author: MJ1234
Session Name: monkeys: mj
Genome Assembly: hg38
Creation Date: 2026-09-17
Views: 4 		1789632000 4
Description: hg38 Figure 1
Author: TLienard30
Session Name: hg38 Figure 1
Genome Assembly: hg38
Creation Date: 2026-09-17
Views: 10 		1789632000 10
Description: Chimp/human comparison
Author: scarpara
Session Name: hg38 Figure 1
Genome Assembly: hg38
Creation Date: 2026-09-17
Views: 4 		1789632000 4
Description: hg38 - Chimp Chr2
Author: simonefortier
Session Name: hg38 - Chimp Chr2
Genome Assembly: hg38
Creation Date: 2026-09-17
Views: 5 		1789632000 5
Description: chimp
Author: umangarupa
Session Name: hg38 chr2 with chimp UR
Genome Assembly: hg38
Creation Date: 2026-09-17
Views: 5 		1789632000 5
Description: chimp synteny
Author: Desideem
Session Name: hg38 chimp ED
Genome Assembly: hg38
Creation Date: 2026-09-17
Views: 3 		1789632000 3
Description: Genomics class bitter taste receptor assignment
Author: nf420
Session Name: hg38 Bitter
Genome Assembly: hg38
Creation Date: 2026-09-17
Views: 4 		1789632000 4
Description: TAS2R38 gene
Author: jasmine_peou
Session Name: human TAS2R38 gene
Genome Assembly: hg38
Creation Date: 2026-09-14
Views: 6 		1789372800 6
Description: 9/15 UCSC Genome Browser SNPs/Mutations/ApE In Class Assignment
Author: sophieraynal
Session Name: TAS2R38 class assignment
Genome Assembly: hg38
Creation Date: 2026-09-15
Views: 4 		1789459200 4
Description: RNA-Seq, ChIP-Seq nd ATAC-Seq from Drosophila melanogaster wild type line wandering larval tissues: salivary glands, brain and wing imaginal discs. ChIP-Seq samples with antibodies against RNA Pol II (Rpb3 ans S5P), TBP, CBP and H3K27Ac are represented in this session. ChIP-Seq tracks are shown as ratio to input DNA.
Author: evdasasha
Session Name: Drosophila Larval Tissue Specific Transcription
Genome Assembly: dm6
Creation Date: 2026-09-14
Views: 4 		1789372800 4
Description: BX545851.6:13534..13629 https://iolcalculator.escrs.org/redisplay?id=2991381
Author: Marked Baby Blue 666
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2026-09-12
Views: 7 		1789200000 7
Description: CBIO350 Example 1 Fall 2026
Author: Bowen
Session Name: ZIC2_T2T
Genome Assembly: hub_3671779_hs1
Creation Date: 2026-09-11
Views: 12 		1789113600 12
Description: Quiz 1 hg18 RHO 9/8.
Author: TLienard30
Session Name: Quiz 1 hg18 RHO 9/8
Genome Assembly: hg38
Creation Date: 2026-09-08
Views: 25 		1788854400 25
Description: Quiz 2 human RHO gene in the hg19 9/8
Author: TLienard30
Session Name: Quiz 2 human RHO gene in the hg19 9/8
Genome Assembly: hg38
Creation Date: 2026-09-08
Views: 20 		1788854400 20
Description: session 2 edited
Author: IsabelleMcShane
Session Name: hg38(RHO) session 2
Genome Assembly: hg38
Creation Date: 2026-09-08
Views: 17 		1788854400 17
Description: Genomics Assignment 2 Getz 9/8
Author: getzge
Session Name: hg38 RHO Highlight
Genome Assembly: hg38
Creation Date: 2026-09-08
Views: 9 		1788854400 9
Description: 2nd assignment for RHO.
Author: nf420
Session Name: hg38 RHO NKF 2
Genome Assembly: hg38
Creation Date: 2026-09-08
Views: 10 		1788854400 10
Description: quiz #1
Author: jasmine_peou
Session Name: hg38 RHO part 1
Genome Assembly: hg38
Creation Date: 2026-09-08
Views: 8 		1788854400 8
Description: Genomics Assignment 1 Getz 9/8
Author: getzge
Session Name: hg38 RHO
Genome Assembly: hg38
Creation Date: 2026-09-08
Views: 10 		1788854400 10
Description: UCSC 100 Vertebrates
Author: simonefortier
Session Name: hg38 RHO Pt.2
Genome Assembly: hg38
Creation Date: 2026-09-08
Views: 9 		1788854400 9
Description: RHO gene, OMIM alleles
Author: simonefortier
Session Name: hg38 RHO
Genome Assembly: hg38
Creation Date: 2026-09-08
Views: 10 		1788854400 10
Description: UCSC Genome Browser Lab Quiz #1
Author: sophieraynal
Session Name: hg38 RHO
Genome Assembly: hg38
Creation Date: 2026-09-07
Views: 17 		1788768000 17
Description: edited session *corrected*
Author: IsabelleMcShane
Session Name: hg38(RHO) session 1
Genome Assembly: hg38
Creation Date: 2026-09-08
Views: 4 		1788854400 4
Description: Q2
Author: Desideem
Session Name: hg38 ED Q2
Genome Assembly: hg38
Creation Date: 2026-09-07
Views: 5 		1788768000 5
Description: hg38 Quiz 2
Author: sachabuxton
Session Name: hg38_2
Genome Assembly: hg38
Creation Date: 2026-09-07
Views: 9 		1788768000 9
Description: session 2
Author: kendallgueli
Session Name: hg38RHO- with multiz
Genome Assembly: hg38
Creation Date: 2026-09-07
Views: 10 		1788768000 10
Description: pt2
Author: MJ1234
Session Name: hg38 RHO part2
Genome Assembly: hg38
Creation Date: 2026-09-07
Views: 9 		1788768000 9
Description: session 1
Author: kendallgueli
Session Name: hg38 RHO
Genome Assembly: hg38
Creation Date: 2026-09-07
Views: 9 		1788768000 9
Description: Genomics class assignment. BIO 481 TuTh 2:20 PM
Author: nf420
Session Name: hg38 RHO NKF
Genome Assembly: hg38
Creation Date: 2026-09-07
Views: 11 		1788768000 11
Description: hg18 RHO
Author: Feldmakl
Session Name: hg18 RHO
Genome Assembly: hg38
Creation Date: 2026-09-07
Views: 7 		1788768000 7
Description: class
Author: MJ1234
Session Name: hg18 RHO
Genome Assembly: hg38
Creation Date: 2026-09-07
Views: 11 		1788768000 11
Description: changed the font and color as well as UCSC 100
Author: umangarupa
Session Name: hg38 RHO color and font UR
Genome Assembly: hg38
Creation Date: 2026-09-07
Views: 13 		1788768000 13
Description: hg38 RHO UR
Author: umangarupa
Session Name: hg38 RHO UR
Genome Assembly: hg38
Creation Date: 2026-09-07
Views: 18 		1788768000 18
Description: RHO GENE
Author: sarahneun
Session Name: hg18RHOsarahneunlist
Genome Assembly: hg38
Creation Date: 2026-09-07
Views: 10 		1788768000 10
Description: hg38 RHO Quiz 2
Author: girouxjm
Session Name: hg38 RHO Quiz 2
Genome Assembly: hg38
Creation Date: 2026-09-07
Views: 5 		1788768000 5
Description: hg38 Rho
Author: girouxjm
Session Name: hg38 RHO
Genome Assembly: hg38
Creation Date: 2026-09-07
Views: 10 		1788768000 10
Description: hg38
Author: Desideem
Session Name: hg18 RHO ED
Genome Assembly: hg38
Creation Date: 2026-09-07
Views: 8 		1788768000 8
Description: hg18 RHO
Author: TLienard30
Session Name: hg18 RHO quiz 2 9/8
Genome Assembly: hg38
Creation Date: 2026-09-07
Views: 24 		1788768000 24
Description: Human hg38 rho gene
Author: scarpara
Session Name: hg38 RHO RS 1
Genome Assembly: hg38
Creation Date: 2026-09-07
Views: 14 		1788768000 14
Description: bio 481 session 1
Author: rebholsm
Session Name: hg38 FoxP2 Conservation SR
Genome Assembly: hg38
Creation Date: 2026-09-03
Views: 16 		1788422400 16
Description: BIO 481 Dr Enke
Author: mick.close
Session Name: hg38 FoxP2 Conservation MC
Genome Assembly: hg38
Creation Date: 2026-09-03
Views: 7 		1788422400 7
Description: FOXP2 gene view for genomics class.
Author: nf420
Session Name: hg38 FOXP2 Conservation NKF
Genome Assembly: hg38
Creation Date: 2026-09-03
Views: 15 		1788422400 15
Description: FoxP2 Quiz SF
Author: simonefortier
Session Name: hg38 FoxP2 Conservation (SF)
Genome Assembly: hg38
Creation Date: 2026-09-03
Views: 6 		1788422400 6
Description: FOXP2 gene for genomics
Author: getzge
Session Name: hg38 FOXP2 Conservation (GG)
Genome Assembly: hg38
Creation Date: 2026-09-03
Views: 6 		1788422400 6
Description: hg38 FoxP2 Conservation (SAB)
Author: sachabuxton
Session Name: hg38 FoxP2 Conservation (SAB).
Genome Assembly: hg38
Creation Date: 2026-09-03
Views: 7 		1788422400 7
Description: Genomics
Author: MJ1234
Session Name: hg38 FoxP2 Conservation (mj)
Genome Assembly: hg38
Creation Date: 2026-09-03
Views: 17 		1788422400 17
Description: hg38 FoxP2 Conservation
Author: umangarupa
Session Name: hg38 FoxP2 Conservation UR
Genome Assembly: hg38
Creation Date: 2026-09-03
Views: 20 		1788422400 20
Description: class work
Author: kendallgueli
Session Name: Fall26- Worm BIO481 group3
Genome Assembly: ce11
Creation Date: 2026-09-03
Views: 8 		1788422400 8
Description: Browser trial run
Author: sophieraynal
Session Name: hg38 FoxP2 Conservation SR
Genome Assembly: hg38
Creation Date: 2026-09-03
Views: 10 		1788422400 10
Description: Reading quiz 2
Author: lilyrodda
Session Name: hg38 FoxP2 Conservation LR
Genome Assembly: hg38
Creation Date: 2026-09-03
Views: 6 		1788422400 6
Description: bio481
Author: kendallgueli
Session Name: hg38 FoxP2 Conservation- KG
Genome Assembly: hg38
Creation Date: 2026-09-02
Views: 224 		1788336000 224
Description: hg38 FoxP2 Conservation mg
Author: mariahgiz07
Session Name: hg38 FoxP2 Conservation MG
Genome Assembly: hg38
Creation Date: 2026-09-02
Views: 38 		1788336000 38
Description: homework
Author: IsabelleMcShane
Session Name: hg38 FoxP2 Conservation(IM)
Genome Assembly: hg38
Creation Date: 2026-09-02
Views: 8 		1788336000 8
Description: Genomics Class FoxP2 Conservation
Author: Feldmakl
Session Name: hg38 FoxP2 Conservation KF
Genome Assembly: hg38
Creation Date: 2026-09-02
Views: 29 		1788336000 29
Description: FoxP2 Gene for BIO481
Author: cox2aa
Session Name: hg38 FoxP2 Conservation AC
Genome Assembly: hg38
Creation Date: 2026-09-02
Views: 11 		1788336000 11
Description: hg38 FoxP2
Author: Desideem
Session Name: hg38 FoxP2 Conservation ED
Genome Assembly: hg38
Creation Date: 2026-09-02
Views: 6 		1788336000 6
Description: Human FOXP2 gene
Author: scarpara
Session Name: hg38 FoxP2 Conservation RS
Genome Assembly: hg38
Creation Date: 2026-09-02
Views: 12 		1788336000 12
Description: FoxP2 Genomics Bio 481
Author: sarahneun
Session Name: hg38FoxP2ConservationSMN
Genome Assembly: hg38
Creation Date: 2026-09-02
Views: 14 		1788336000 14
Description: hg38 FoxP2 Conservation (your Initials here)
Author: girouxjm
Session Name: hg38 FoxP2 Conservation JG
Genome Assembly: hg38
Creation Date: 2026-09-02
Views: 9 		1788336000 9
Description: hg38 RHO
Author: sachabuxton
Session Name: hg38 RHO
Genome Assembly: hg38
Creation Date: 2026-09-06
Views: 13 		1788681600 13
Description: hg18 RHO
Author: mariahgiz07
Session Name: hg18 RHO
Genome Assembly: hg38
Creation Date: 2026-09-06
Views: 13 		1788681600 13
Description: Genomic tracks generated for the manuscript "TRIM28 preserves ovarian identity by stabiliZing lineage-specific transcription factor hubs"
Author: IStevant
Session Name: TRIM28_mouse_ovary
Genome Assembly: mm10
Creation Date: 2026-07-24
Views: 206 		1784880000 206
Description: Interesting peak near SIRT1
Author: brianlee
Session Name: SIRT1_intergenic_Peak
Genome Assembly: hg38
Creation Date: 2026-07-23
Views: 160 		1784793600 160
Description: DANIO-ReCODE workshop Croatia 17.06.2026.
Author: kmandic
Session Name: DC-workshop
Genome Assembly: hg19
Creation Date: 2026-06-11
Views: 326 		1781164800 326
Description: Expression tracks on hg38 on the KLK3 loci.
Author: Lou
Session Name: expressionKLK3
Genome Assembly: hg38
Creation Date: 2026-06-09
Views: 238 		1780992000 238
Description: The second part of the quiz
Author: sarahneun
Session Name: hg38RHOsarahneunlist2
Genome Assembly: hg38
Creation Date: 2026-09-07
Views: 9 		1788768000 9
Description: rna+atac seq FTL_700, subsetted to D3 MSN cells
Author: agurha
Session Name: rn6
Genome Assembly: rn6
Creation Date: 2026-05-14
Views: 228 		1778745600 228
Description: BHlhe40_KO_WT_ChIP-Seq
Author: songj11
Session Name: Bhlhe40_KO_WT_ChIP_mm10_bs50
Genome Assembly: mm10
Creation Date: 2026-05-08
Views: 19 		1778227200 19
Description: adasjas
Author: adasjas
Session Name: ReMap-ChIP TFs saMB1_2
Genome Assembly: hg19
Creation Date: 2026-05-08
Views: 118 		1778227200 118
Description: RNA-seq, CTCF CUT&RUN, H3K27ac ChIP-seq, ATAC-seq and H3K27ac HiChIP tracks for EBNA2-on/off in B cell.
Author: v8syooo
Session Name: EBNAon/off
Genome Assembly: hg19
Creation Date: 2026-05-06
Views: 129 		1778054400 129
Screenshot not available
Click Here to view
 Description: https://doi.org/10.1016/j.xhgg.2026.100630
Author: Wen-Cheng
Session Name: Liver_rs1501908
Genome Assembly: hg19
Creation Date: 2026-03-16
Views: 72 		1773648000 72
Description: This session is a zoomed-in view of the CYP2D6 variant, R296C, which is one of the two variants that define the *2 haplotype.
Author: mtzimmermann
Session Name: CYP2D6 R296C
Genome Assembly: hg38
Creation Date: 2026-03-11
Views: 614 		1773216000 614
Description: TODO
Author: tsb31
Session Name: ADLD
Genome Assembly: hg38
Creation Date: 2026-04-02
Views: 183 		1775116800 183
Description: ok.
Author: soham.pandya
Session Name: test_bed_track
Genome Assembly: hg19
Creation Date: 2026-03-03
Views: 313 		1772524800 313
Description: Main GENOVESA CNV visualisation
Author: zgtman
Session Name: Genovesa_CNV
Genome Assembly: hg38
Creation Date: 2026-03-02
Views: 268 		1772438400 268
Description: big wigs and bams for Shank3 area etc.
Author: asabrantes
Session Name: SFARI Shank3 Acr Gad1 etcs. mm39
Genome Assembly: mm39
Creation Date: 2026-02-24
Views: 209 		1771920000 209
Description: Unfiltered vcf files from Mutect2 variant calling of HAP1 subclones KO for BER or MMR genes.
Author: abortoli
Session Name: hg38_HAP1_NAR_a
Genome Assembly: hg38
Creation Date: 2026-02-24
Views: 71 		1771920000 71
Description: Alignments to sacCer3 for the 2026W MGY 360 strain collection
Author: morganalford
Session Name: 26W MGY 360
Genome Assembly: sacCer3
Creation Date: 2026-02-23
Views: 159 		1771833600 159
Description: https://doi.org/10.1016/j.xhgg.2026.100630
Author: Wen-Cheng
Session Name: Liver_rs17573010
Genome Assembly: hg19
Creation Date: 2026-03-16
Views: 53 		1773648000 53
Description: RNAseq data comparing the parent and ddaA mutant gene expression when grown in the presence of mitomycin C
Author: ckellison
Session Name: MMC_gene_expression
Genome Assembly: hub_6730860_GCF_000046845.1
Creation Date: 2026-02-16
Views: 128 		1771228800 128
Description: For the purposes of phylogenetic footprinting in the HCRT promoter. In this data set, the TSS is at position 42,185,452 and the promoter is visualized in reverse view
Author: ChristianWohlfeld
Session Name: HCRT_promoter_2026
Genome Assembly: hg38
Creation Date: 2026-02-13
Views: 120 		1770969600 120
Description: FoxP2 gene session
Author: jasmine_peou
Session Name: hg38 FoxP2 Conservation JP
Genome Assembly: hg38
Creation Date: 2026-09-02
Views: 10 		1788336000 10
Description: sacCer3 ED
Author: Desideem
Session Name: sacCer3 ED
Genome Assembly: sacCer3
Creation Date: 2026-09-03
Views: 4 		1788422400 4
Description: BIO481 Assignment for 9/3/26
Author: cox2aa
Session Name: Fall26 MouseBIO481 group3
Genome Assembly: mm39
Creation Date: 2026-09-03
Views: 6 		1788422400 6
Description: Fall26 Yeast BIO481 group1
Author: echen971
Session Name: Fall26 Yeast BIO481 group1
Genome Assembly: sacCer3
Creation Date: 2026-09-03
Views: 20 		1788422400 20
Description: worm group project
Author: IsabelleMcShane
Session Name: Fall26 Worm BIO481 group3
Genome Assembly: ce11
Creation Date: 2026-09-03
Views: 6 		1788422400 6
Description: would you still love me if I was a worm?
Author: getzge
Session Name: Fall26 Worm BIO481 group 3
Genome Assembly: ce11
Creation Date: 2026-09-03
Views: 14 		1788422400 14
Description: Worm Group work
Author: Feldmakl
Session Name: Fall26 Worm BIO481 group #3
Genome Assembly: ce11
Creation Date: 2026-09-03
Views: 6 		1788422400 6
Description: Genomics group 1
Author: MJ1234
Session Name: Fall26 Yeast BIO481 group1
Genome Assembly: sacCer3
Creation Date: 2026-09-03
Views: 8 		1788422400 8
Description: Fall25 Yeast BIO481 class work
Author: sophieraynal
Session Name: Fall25 Yeast BIO481 group #1
Genome Assembly: sacCer3
Creation Date: 2026-09-03
Views: 6 		1788422400 6
Description: Mouse mm39
Author: scarpara
Session Name: Fall26 MouseBIO481 group5
Genome Assembly: mm39
Creation Date: 2026-09-03
Views: 19 		1788422400 19
Description: mouse
Author: umangarupa
Session Name: Fall26 MouseBIO481 group#6 UR
Genome Assembly: mm39
Creation Date: 2026-09-03
Views: 8 		1788422400 8
Description: Fall26 Worm BIO481 group4
Author: sachabuxton
Session Name: CGEMS WORM (SAB) TEST
Genome Assembly: ce11
Creation Date: 2026-09-03
Views: 10 		1788422400 10
Description: Fall26 Mouse BIO 481 Group 6 Sarah
Author: sarahneun
Session Name: Fall26MouseBIO481group6SMN
Genome Assembly: mm39
Creation Date: 2026-09-03
Views: 2 		1788422400 2
Description: EGD2 gene view for genomics class.
Author: nf420
Session Name: Fall26 Yeast BIO481 Group 1 NKF
Genome Assembly: sacCer3
Creation Date: 2026-09-03
Views: 7 		1788422400 7
Description: Fall26 MouseBIO481 group#3 TL
Author: TLienard30
Session Name: Fall26 MouseBIO481 group#3 TL
Genome Assembly: mm39
Creation Date: 2026-09-03
Views: 11 		1788422400 11
Description: Group 5 session
Author: girouxjm
Session Name: Fall26 MouseBIO481/581 group#5
Genome Assembly: mm39
Creation Date: 2026-09-03
Views: 3 		1788422400 3
Description: Fall25 Yeast BIO481 group 2
Author: simonefortier
Session Name: Fall25 Yeast BIO481 group 2
Genome Assembly: sacCer3
Creation Date: 2026-09-03
Views: 5 		1788422400 5
Description: Fall 25 Worm BIO481 Group #3
Author: mariahgiz07
Session Name: Fall 25 Worm BIO481 Group #3
Genome Assembly: ce11
Creation Date: 2026-09-03
Views: 9 		1788422400 9
Description: Fall26 Yeast BIO481 group1
Author: jasmine_peou
Session Name: Fall26 Yeast BIO481 group 2
Genome Assembly: sacCer3
Creation Date: 2026-09-03
Views: 8 		1788422400 8
Description: ica
Author: Desideem
Session Name: hg38 TASR38 ED inclassassignment
Genome Assembly: hg38
Creation Date: 2026-09-15
Views: 3 		1789459200 3
Description: genome activity sarah m neun
Author: sarahneun
Session Name: hg38browseractivitysmn
Genome Assembly: hg38
Creation Date: 2026-09-15
Views: 3 		1789459200 3
Description: TAS2R38 gene in class assignment 9/15
Author: TLienard30
Session Name: TAS2R38 gene in class assignment
Genome Assembly: hg38
Creation Date: 2026-09-15
Views: 3 		1789459200 3
Description: Bitter Taste SNP
Author: simonefortier
Session Name: hg38-Bitter Taste SNP
Genome Assembly: hg38
Creation Date: 2026-09-15
Views: 4 		1789459200 4
Description: ChIP-seq peak regions for visualization in UCSC Genome Browser
Author: hkarakoyun23@ku.edu.tr
Session Name: hazal_peaks56
Genome Assembly: hg38
Creation Date: 2026-04-12
Views: 71 		1775980800 71
Description: Gene track for bio 580L.
Author: cooperki
Session Name: TAS2R38_Gene_BIO580L
Genome Assembly: hg19
Creation Date: 2026-01-27
Views: 145 		1769500800 145
Description: Quiz 1 tracks.
Author: cooperki
Session Name: hg38_RHO
Genome Assembly: hg38
Creation Date: 2026-01-27
Views: 113 		1769500800 113
Description: Argonautes and small RNAs associated with nematode programmed DNA elimination
Author: MVZ
Session Name: small_RNAs
Genome Assembly: hub_4238208_v37
Creation Date: 2025-12-13
Views: 375 		1765612800 375
Description: Anti-BATF ChIP on FACS-purified, bone marrow–derived pDCs at steady state and after 2 h of CpG stimulation.
Author: AliSh
Session Name: BATF_pDCs
Genome Assembly: mm10
Creation Date: 2025-12-11
Views: 219 		1765440000 219
Description: for final presentation
Author: ashelhorse
Session Name: ClinicalVarSCN9A
Genome Assembly: hg38
Creation Date: 2025-12-09
Views: 271 		1765267200 271
Description: Annotation of LCT and MCM6 Genes
Author: Caesaram
Session Name: LCT and MCM6 Gene (F)
Genome Assembly: hg38
Creation Date: 2025-12-09
Views: 77 		1765267200 77
Description: HBB gene showing snips where sickle cell mutation occurs, as well as graph showing how HBB is only expressed in blood cells
Author: allygarrett
Session Name: hg38 - HBB gene
Genome Assembly: hg38
Creation Date: 2025-12-04
Views: 71 		1764835200 71
Description: CRX uniprot assignment
Author: allygarrett
Session Name: hg38 - CRX protein Uniprot
Genome Assembly: hg38
Creation Date: 2025-12-02
Views: 97 		1764662400 97
Description: isoforms figure 1
Author: sronalds
Session Name: CRX_isoforms
Genome Assembly: hg38
Creation Date: 2025-12-02
Views: 60 		1764662400 60
Description: View of CRX gene and its isoforms with tracks enabled to show possible mutations
Author: messicbr
Session Name: hg38 CRX w/ splice and isoforms
Genome Assembly: hg38
Creation Date: 2025-12-02
Views: 59 		1764662400 59
Description: CRX gene isoforms
Author: MadisonTesnow
Session Name: hg38 CRX gene isoforms Madison Tesnow
Genome Assembly: hg38
Creation Date: 2025-12-02
Views: 78 		1764662400 78
Description: pde6c/rbp4
Author: katelynnmenjivar
Session Name: mm9 KM PDE6C/RBP4 locus
Genome Assembly: mm9
Creation Date: 2025-11-18
Views: 121 		1763452800 121
Description: PDE6C/RBP4 locus mm9
Author: oliviakloc
Session Name: PDE6C/RBP4 locus mm9
Genome Assembly: mm9
Creation Date: 2025-11-18
Views: 85 		1763452800 85
Description: guca1b/guca1a
Author: katelynnmenjivar
Session Name: mm9 KM GUCA1B/GUCA1A locus
Genome Assembly: mm9
Creation Date: 2025-11-18
Views: 72 		1763452800 72
Description: nrl/cpne6
Author: katelynnmenjivar
Session Name: mm9 KM NRL/CPNE6 locus
Genome Assembly: mm9
Creation Date: 2025-11-18
Views: 67 		1763452800 67
Description: rho/h1foo
Author: katelynnmenjivar
Session Name: mm9 KM RHO/H1FOO
Genome Assembly: mm9
Creation Date: 2025-11-18
Views: 48 		1763452800 48
Description: In class assignment view of RHO/H1FOO with CBRs, mRNAs, and DHS.
Author: LucaDooley
Session Name: mm9 RHO/H1FOO CBR,mRNA&DHS
Genome Assembly: mm9
Creation Date: 2025-11-18
Views: 42 		1763452800 42
Description: Had to delete the other this is the working view
Author: sronalds
Session Name: PDE6C/RBP4_SRonalds_BIO581_Real
Genome Assembly: mm9
Creation Date: 2025-11-18
Views: 51 		1763452800 51
Description: In class assignment view of PDE6C/RBP4 with CBRs, mRNAs, and DHS.
Author: LucaDooley
Session Name: mm9 PDE6C/RBP4 CBR,mRNA&DHS
Genome Assembly: mm9
Creation Date: 2025-11-18
Views: 47 		1763452800 47
Description: View of the fully RHO gene with custom tracks for wild type and NRL enabled
Author: messicbr
Session Name: mm9 RHO_WT/NRL
Genome Assembly: mm9
Creation Date: 2025-11-18
Views: 40 		1763452800 40
Description: mm9 CRX, mRNA, Dnase1 on NRL
Author: Elizabeth McLaughlin
Session Name: mm9 CRX, mRNA, Dnase1 on NRL
Genome Assembly: mm9
Creation Date: 2025-11-18
Views: 48 		1763452800 48
Description: Good zooming
Author: sronalds
Session Name: NRL/CPNE6_Sronalds_BIO581
Genome Assembly: mm9
Creation Date: 2025-11-18
Views: 44 		1763452800 44
Description: PDE6C
Author: Caesaram
Session Name: CBR/mRNA PDE6C day1week1week8
Genome Assembly: mm9
Creation Date: 2025-11-18
Views: 37 		1763452800 37
Description: NRL
Author: Caesaram
Session Name: CBR/mRNA NRL day1week1week8
Genome Assembly: mm9
Creation Date: 2025-11-18
Views: 79 		1763452800 79
Description: GUCA1B/GUCA1A locus mm9
Author: oliviakloc
Session Name: GUCA1B/GUCA1A locus mm9
Genome Assembly: mm9
Creation Date: 2025-11-18
Views: 36 		1763452800 36
Description: Not super zoomed in
Author: sronalds
Session Name: GUCA1B/A_SRonalds_BIO581
Genome Assembly: mm9
Creation Date: 2025-11-18
Views: 44 		1763452800 44
Description: all data
Author: katelynnmenjivar
Session Name: mm9 all data KM
Genome Assembly: mm9
Creation Date: 2025-11-18
Views: 47 		1763452800 47
Description: In class assignment view of NRL/CPNE6 with CBRs, mRNAs, and DHS.
Author: LucaDooley
Session Name: mm9 NRL/CPNE6 CBR,mRNA&DHS
Genome Assembly: mm9
Creation Date: 2025-11-18
Views: 39 		1763452800 39
Description: In class assignment view of GUCA1a/1b with CBRs, mRNAs, and DHS.
Author: LucaDooley
Session Name: mm9 GUCA1a/1b CBR,mRNA&DHS
Genome Assembly: mm9
Creation Date: 2025-11-18
Views: 49 		1763452800 49
Description: NRL/CPNE6 locus mm9
Author: oliviakloc
Session Name: NRL/CPNE6 locus mm9
Genome Assembly: mm9
Creation Date: 2025-11-18
Views: 44 		1763452800 44
Description: super zoomed in
Author: sronalds
Session Name: RHO/H1FOO_Sronalds_BIO581
Genome Assembly: mm9
Creation Date: 2025-11-18
Views: 45 		1763452800 45
Description: GUCA
Author: Caesaram
Session Name: CBR/mRNA GUCA day1week1week8
Genome Assembly: mm9
Creation Date: 2025-11-18
Views: 44 		1763452800 44
Description: Fixed view of the NRL/CPNE6 genes with custom tracks for wild type and NRL retina tissue as well as CBR tracks
Author: messicbr
Session Name: mm9 NRL/CPNE6 w/ NR1 (updated)
Genome Assembly: mm9
Creation Date: 2025-11-18
Views: 69 		1763452800 69
Description: CBR and mRNA in class practice
Author: allygarrett
Session Name: mm9 CBR and mRNA - AGarrett
Genome Assembly: mm9
Creation Date: 2025-11-18
Views: 42 		1763452800 42
Description: mm9 everything PDE6C
Author: Elizabeth Callis
Session Name: mm9 everything PDE6C
Genome Assembly: mm9
Creation Date: 2025-11-18
Views: 46 		1763452800 46
Description: mm9 everything GUCA1B
Author: Elizabeth Callis
Session Name: mm9 everything GUCA1B
Genome Assembly: mm9
Creation Date: 2025-11-18
Views: 39 		1763452800 39
Description: DHS seq mm9 on RHO gene
Author: oliviakloc
Session Name: Combined tracks- DHS seq mm9
Genome Assembly: mm9
Creation Date: 2025-11-18
Views: 39 		1763452800 39
Description: mm9 everything NRL
Author: Elizabeth Callis
Session Name: mm9 everything NRL
Genome Assembly: mm9
Creation Date: 2025-11-18
Views: 43 		1763452800 43
Description: CBR practice
Author: ashelhorse
Session Name: mm9.3
Genome Assembly: mm9
Creation Date: 2025-11-18
Views: 46 		1763452800 46
Description: in class assignment 11/18
Author: lgunter15
Session Name: mm9_mRNA_custom_tracks_gunter
Genome Assembly: mm9
Creation Date: 2025-11-18
Views: 47 		1763452800 47
Description: View of PDE6c Exons 1-16 showing custom wt and NR1 retina tracks with complementary CBR tracks.
Author: messicbr
Session Name: mm9 PDE6C
Genome Assembly: mm9
Creation Date: 2025-11-18
Views: 88 		1763452800 88
Description: mm9 everything RHO
Author: Elizabeth Callis
Session Name: mm9 everything RHO
Genome Assembly: mm9
Creation Date: 2025-11-18
Views: 43 		1763452800 43
Description: The template that will be used for the figures for 11/18/2025 class (have chip seq and rna seq custom tracks)
Author: sronalds
Session Name: RHO_CRX_Fig1_Template_SRonalds_BIO581
Genome Assembly: mm9
Creation Date: 2025-11-18
Views: 87 		1763452800 87
Description: wt & Nrl-
Author: katelynnmenjivar
Session Name: mm9 mouse wt & Nrl-
Genome Assembly: mm9
Creation Date: 2025-11-18
Views: 33 		1763452800 33
Description: View of GUCA1B and GUCA1A with custom tracks for wt retina and NR1 retina, with DNase 1 hypersensitivity enabled
Author: messicbr
Session Name: mm9 GUCA1B/GUCA1B
Genome Assembly: mm9
Creation Date: 2025-11-18
Views: 36 		1763452800 36
Description: All custom tracks with Nrl- RNA-seq, wt RNA-seq, and ChIP-seq data
Author: oliviakloc
Session Name: CRX CHIP-seq mm9
Genome Assembly: mm9
Creation Date: 2025-11-18
Views: 79 		1763452800 79
Description: View of NRL and CPNE6 with custom track for wt and NR1 retinas
Author: messicbr
Session Name: mm9 NRL/CPNE6 w/ NR1
Genome Assembly: mm9
Creation Date: 2025-11-18
Views: 52 		1763452800 52
Description: Combined CBR and mRNA data
Author: LucaDooley
Session Name: mm9 RHO CBR&mRNA
Genome Assembly: mm9
Creation Date: 2025-11-18
Views: 49 		1763452800 49
Description: View of MM9 Exon 1 of RHO with custom tracks showing NR1 Retina
Author: messicbr
Session Name: mm9_RHO Exon1 NR1
Genome Assembly: mm9
Creation Date: 2025-11-18
Views: 42 		1763452800 42
Description: d1 expression, wk1 expression, wk2 expression
Author: Caesaram
Session Name: CBR/mRNA RHO day1week1week8
Genome Assembly: mm9
Creation Date: 2025-11-18
Views: 43 		1763452800 43
Description: mm9 wt and nrl CRX binding sites
Author: MadisonTesnow
Session Name: mm9 wt and nrl CRX binding sites Madison Tesnow
Genome Assembly: mm9
Creation Date: 2025-11-18
Views: 40 		1763452800 40
Description: mm9 Chip-seq + mRNA
Author: Elizabeth Callis
Session Name: mm9 Chip-seq + mRNA
Genome Assembly: mm9
Creation Date: 2025-11-18
Views: 31 		1763452800 31
Description: CRX binding regions and mRNA expression in the RHO gene
Author: Caesaram
Session Name: CBR/mRNA RHO Mouse mm9
Genome Assembly: mm9
Creation Date: 2025-11-18
Views: 44 		1763452800 44
Description: mouse genome in-class assignment
Author: lgunter15
Session Name: mm9_Rho_mouse_retina_gunter
Genome Assembly: mm9
Creation Date: 2025-11-18
Views: 33 		1763452800 33
Description: View of wt and Nrl- CRX Binding sites on RHO.
Author: LucaDooley
Session Name: mm9 RHO CBRs
Genome Assembly: mm9
Creation Date: 2025-11-18
Views: 76 		1763452800 76
Description: In class
Author: sronalds
Session Name: RHO_CRX_Binding_SRonalds_BIO581
Genome Assembly: mm9
Creation Date: 2025-11-18
Views: 39 		1763452800 39
Description: aw in class crb mm9
Author: averywitt
Session Name: mm9 CRB
Genome Assembly: mm9
Creation Date: 2025-11-18
Views: 40 		1763452800 40
Description: CBRs in wildtype and Nrl-
Author: oliviakloc
Session Name: CBRs mm9
Genome Assembly: mm9
Creation Date: 2025-11-18
Views: 39 		1763452800 39
Description: mm9 CRX activity
Author: allygarrett
Session Name: mm9 CBR - Allison Garrett
Genome Assembly: mm9
Creation Date: 2025-11-18
Views: 39 		1763452800 39
Description: mm9 RHO 2
Author: Elizabeth Callis
Session Name: mm9 RHO 2
Genome Assembly: mm9
Creation Date: 2025-11-18
Views: 38 		1763452800 38
Description: CRX binding regions along RHO gen in Mouse
Author: Caesaram
Session Name: CBR RHO Mouse mm9
Genome Assembly: mm9
Creation Date: 2025-11-18
Views: 46 		1763452800 46
Description: PDE6B
Author: katelynnmenjivar
Session Name: hg38 PDE6B-KM
Genome Assembly: hg38
Creation Date: 2025-11-13
Views: 44 		1763020800 44
Description: PDE6A
Author: katelynnmenjivar
Session Name: hg38 PDE6A-KM
Genome Assembly: hg38
Creation Date: 2025-11-13
Views: 59 		1763020800 59
Description: GNAT2
Author: katelynnmenjivar
Session Name: hg38 GNAT 2-KM
Genome Assembly: hg38
Creation Date: 2025-11-13
Views: 45 		1763020800 45
Description: PDE6B rod and cone mRNA
Author: oliviakloc
Session Name: PDE6B exons 1-3 hg38
Genome Assembly: hg38
Creation Date: 2025-11-13
Views: 56 		1763020800 56
Description: GNAT1
Author: katelynnmenjivar
Session Name: hg38 GNAT1-KM
Genome Assembly: hg38
Creation Date: 2025-11-13
Views: 51 		1763020800 51
Description: dsdawd
Author: sronalds
Session Name: PDE6A_BIO581_SRonalds
Genome Assembly: hg38
Creation Date: 2025-11-13
Views: 59 		1763020800 59
Description: hg38 PDE6B gene
Author: Elizabeth Callis
Session Name: hg38 PDE6B gene
Genome Assembly: hg38
Creation Date: 2025-11-13
Views: 43 		1763020800 43
Description: Bam plot for macular and peripheral retina on for GNAT 2 expression.
Author: LucaDooley
Session Name: hg38 bam plot GNAT2
Genome Assembly: hg38
Creation Date: 2025-11-13
Views: 63 		1763020800 63
Description: hg38 GNAT2
Author: Elizabeth McLaughlin
Session Name: hg38 GNAT2
Genome Assembly: hg38
Creation Date: 2025-11-13
Views: 75 		1763020800 75
Description: PDE6A rod and cone mRNA
Author: oliviakloc
Session Name: PDE6A exon2 hg38
Genome Assembly: hg38
Creation Date: 2025-11-13
Views: 45 		1763020800 45
Description: hg38 GNAT1 exon 1
Author: Elizabeth McLaughlin
Session Name: hg38 GNAT1 exon 1
Genome Assembly: hg38
Creation Date: 2025-11-13
Views: 76 		1763020800 76
Description: View of Exons 20-22 of PDE6B with custom macula and retinal tracks enabled
Author: messicbr
Session Name: hg38 PDE6B Exons 20-22 BM
Genome Assembly: hg38
Creation Date: 2025-11-13
Views: 46 		1763020800 46
Description: hg38 GNAT 2 gene
Author: Elizabeth Callis
Session Name: hg38 GNAT 2 gene
Genome Assembly: hg38
Creation Date: 2025-11-13
Views: 63 		1763020800 63
Description: hg38 PDE6A exon 2
Author: Elizabeth McLaughlin
Session Name: hg38 PDE6A exon 2
Genome Assembly: hg38
Creation Date: 2025-11-13
Views: 64 		1763020800 64
Description: hg38 GNAT 1 gene
Author: Elizabeth Callis
Session Name: hg38 GNAT 1 gene
Genome Assembly: hg38
Creation Date: 2025-11-13
Views: 49 		1763020800 49
Description: PED6a 1st 3 exons, macular and peripheral degeneration
Author: Will42ka
Session Name: PED6A_1st3_exons
Genome Assembly: hg38
Creation Date: 2025-11-13
Views: 50 		1763020800 50
Description: hg38 PDE6E exons 1-3
Author: Elizabeth McLaughlin
Session Name: hg38 PDE6B exons 1-3
Genome Assembly: hg38
Creation Date: 2025-11-13
Views: 48 		1763020800 48
Description: View of GNAT2 with macular and retinal custom tracks enabled
Author: messicbr
Session Name: hg38_GNAT2 BM
Genome Assembly: hg38
Creation Date: 2025-11-13
Views: 53 		1763020800 53
Description: GNAT1 rod and cone mRNA
Author: oliviakloc
Session Name: GNAT1 exon1 hg38
Genome Assembly: hg38
Creation Date: 2025-11-13
Views: 45 		1763020800 45
Description: hhh
Author: sronalds
Session Name: GNAT1_BIO581_Sronalds
Genome Assembly: hg38
Creation Date: 2025-11-13
Views: 58 		1763020800 58
Description: View of GNAT1 Exon 1 with Macular and Retinal custom tracks
Author: messicbr
Session Name: hg38_GNAT1_Exon1 Messick
Genome Assembly: hg38
Creation Date: 2025-11-13
Views: 43 		1763020800 43
Description: GNAT2 rod and cone mRNA
Author: oliviakloc
Session Name: GNAT2 hg38
Genome Assembly: hg38
Creation Date: 2025-11-13
Views: 54 		1763020800 54
Description: gnat1 1st exon, macular and peripheral degeneration
Author: Will42ka
Session Name: hg38_gnat1_1st_exon
Genome Assembly: hg38
Creation Date: 2025-11-13
Views: 53 		1763020800 53
Description: View of the second exon of PDE6A with Retinal and Macular Custom Tracks enabled
Author: messicbr
Session Name: hg38 PDE6A_Exon2 BM
Genome Assembly: hg38
Creation Date: 2025-11-13
Views: 49 		1763020800 49
Description: hg38 PDE6A gene
Author: Elizabeth Callis
Session Name: hg38 PDE6A gene
Genome Assembly: hg38
Creation Date: 2025-11-13
Views: 51 		1763020800 51
Description: Custom Tracks
Author: Caesaram
Session Name: Mac/Ret Gnat2
Genome Assembly: hg38
Creation Date: 2025-11-13
Views: 55 		1763020800 55
Description: Custom Tracks
Author: Caesaram
Session Name: Mac/Ret Gnat1
Genome Assembly: hg38
Creation Date: 2025-11-13
Views: 49 		1763020800 49
Description: Custom Tracks
Author: Caesaram
Session Name: Mac/Ret PDE6A
Genome Assembly: hg38
Creation Date: 2025-11-13
Views: 52 		1763020800 52
Description: gnat 2, macular and peripheral degeneration
Author: Will42ka
Session Name: hg38_Gnat2_mac_per
Genome Assembly: hg38
Creation Date: 2025-11-13
Views: 50 		1763020800 50
Description: Custom Tracks
Author: Caesaram
Session Name: Mac/Ret PDE6B
Genome Assembly: hg38
Creation Date: 2025-11-13
Views: 51 		1763020800 51
Description: Practice BAM files using cones and rods
Author: allygarrett
Session Name: Practice Bam - Allison Garrett
Genome Assembly: hg38
Creation Date: 2025-11-13
Views: 54 		1763020800 54
Description: PED6b 1st 3 exons, macular and peripheral degeneration
Author: Will42ka
Session Name: hg38_pde6b_1st3_exons
Genome Assembly: hg38
Creation Date: 2025-11-13
Views: 62 		1763020800 62
Description: blhgfhyj
Author: sronalds
Session Name: GNAT2_BIO581_SRonalds
Genome Assembly: hg38
Creation Date: 2025-11-13
Views: 58 		1763020800 58
Description: hg38 MAPT gene custom track Gencode v49
Author: MadisonTesnow
Session Name: FINAL hg38 MAPT gene custom track Gencode v49
Genome Assembly: hg38
Creation Date: 2025-11-11
Views: 106 		1762848000 106
Description: MAPT mutant alleles found on chromosome 17 in the human hg38 assembly
Author: ashelhorse
Session Name: MAPTcustumtrackAS
Genome Assembly: hg38
Creation Date: 2025-11-11
Views: 82 		1762848000 82
Description: Practice for making and editing custom tracks
Author: allygarrett
Session Name: hg38 MAPT custom tracks
Genome Assembly: hg38
Creation Date: 2025-11-11
Views: 65 		1762848000 65
Description: BED data exercise
Author: ashelhorse
Session Name: hg38 2013 MAPT mutationsAS
Genome Assembly: hg38
Creation Date: 2025-11-11
Views: 43 		1762848000 43
Description: in class custom track
Author: averywitt
Session Name: hg38 MAPT custom track AW
Genome Assembly: hg38
Creation Date: 2025-11-11
Views: 39 		1762848000 39
Description: in class assignment 11/11
Author: lgunter15
Session Name: hg38_MAPT_assignment_gunter
Genome Assembly: hg38
Creation Date: 2025-11-11
Views: 52 		1762848000 52
Description: hg38
Author: sronalds
Session Name: Fall25_CustomTrackhg38_Group6_BIO581
Genome Assembly: hg38
Creation Date: 2025-11-11
Views: 56 		1762848000 56
Description: MAPT mutations custom track
Author: oliviakloc
Session Name: Custom track MAPT hg38
Genome Assembly: hg38
Creation Date: 2025-11-11
Views: 50 		1762848000 50
Description: custom track, mutations in mapt
Author: Will42ka
Session Name: hg38_custom_track
Genome Assembly: hg38
Creation Date: 2025-11-11
Views: 45 		1762848000 45
Description: MAPT gene with mutant alleles
Author: Elizabeth Callis
Session Name: MAPT Gene
Genome Assembly: hg38
Creation Date: 2025-11-11
Views: 66 		1762848000 66
Description: mapt
Author: alexandratrias
Session Name: hg38_MAPT
Genome Assembly: hg38
Creation Date: 2025-11-11
Views: 55 		1762848000 55
Description: custom data
Author: zshiff
Session Name: hg38-customdata-11/11
Genome Assembly: hg38
Creation Date: 2025-11-11
Views: 85 		1762848000 85
Description: MAPT Custom Track with GENECODE V36 w/o splice variants enabled.
Author: messicbr
Session Name: BM MAPT Custom Track
Genome Assembly: hg38
Creation Date: 2025-11-11
Views: 56 		1762848000 56
Description: hg38 MAPT mutation alleles custom track on 11/11
Author: Elizabeth McLaughlin
Session Name: hg38 MAPT mutation alleles custom track 11/11
Genome Assembly: hg38
Creation Date: 2025-11-11
Views: 58 		1762848000 58
Description: in class custom track
Author: averywitt
Session Name: hg19 RHO custom AW
Genome Assembly: hg19
Creation Date: 2025-11-11
Views: 55 		1762848000 55
Description: hg19
Author: sronalds
Session Name: Fall25_CustomTrackhg19_Group6_BIO581
Genome Assembly: hg19
Creation Date: 2025-11-11
Views: 38 		1762848000 38
Description: hg19 Human RHO gene Custom track
Author: MadisonTesnow
Session Name: hg19 Human RHO gene Custom track
Genome Assembly: hg19
Creation Date: 2025-11-11
Views: 49 		1762848000 49
Description: hg38 MAPT mutant alleles 11/11/25
Author: Delleeb
Session Name: hg38 MAPT Mutations 11/11/25
Genome Assembly: hg38
Creation Date: 2025-11-11
Views: 41 		1762848000 41
Description: Hg 38 chr17 custome track practice
Author: Caesaram
Session Name: hg38 custom track
Genome Assembly: hg38
Creation Date: 2025-11-11
Views: 44 		1762848000 44
Description: class assignment
Author: shifflzk
Session Name: mm9 11/6
Genome Assembly: mm9
Creation Date: 2025-11-06
Views: 45 		1762416000 45
Description: Trpm1 isoforms in mouse genome
Author: oliviakloc
Session Name: Trpm1 mm9
Genome Assembly: mm9
Creation Date: 2025-11-06
Views: 41 		1762416000 41
Description: Figure 2
Author: allygarrett
Session Name: mm9 Figure 2 AGarrett
Genome Assembly: mm9
Creation Date: 2025-11-06
Views: 45 		1762416000 45
Description: rho Trpm1
Author: ashelhorse
Session Name: mm9.2
Genome Assembly: mm9
Creation Date: 2025-11-06
Views: 49 		1762416000 49
Description: Trpm1 gene mouse
Author: MadisonTesnow
Session Name: Trpm1 gene mouse figure 2 madison tesnow
Genome Assembly: mm9
Creation Date: 2025-11-06
Views: 60 		1762416000 60
Description: in class figure 2
Author: averywitt
Session Name: mm9 trpm1 aw
Genome Assembly: mm9
Creation Date: 2025-11-06
Views: 55 		1762416000 55
Description: mouse mm9 Trpm 1 class assignment
Author: katelynnmenjivar
Session Name: mm9 Trpm1-KM
Genome Assembly: mm9
Creation Date: 2025-11-06
Views: 51 		1762416000 51
Description: rho mm9
Author: ashelhorse
Session Name: mm9
Genome Assembly: mm9
Creation Date: 2025-11-06
Views: 82 		1762416000 82
Description: trpm1
Author: sronalds
Session Name: Fall25_trpm1_BIO581_Group6
Genome Assembly: mm9
Creation Date: 2025-11-06
Views: 50 		1762416000 50
Description: mouse mm9 rho in class assignment
Author: katelynnmenjivar
Session Name: mm9 rho-KM
Genome Assembly: mm9
Creation Date: 2025-11-06
Views: 58 		1762416000 58
Description: trpm1 gene
Author: Will42ka
Session Name: mm9_trpm1_
Genome Assembly: mm9
Creation Date: 2025-11-06
Views: 42 		1762416000 42
Description: Mouse Trpm 1 gene with day 1, week 1, and week 8 DNase 1 HS
Author: Elizabeth McLaughlin
Session Name: mm9 Trpm1 DNase 1 HS
Genome Assembly: mm9
Creation Date: 2025-11-06
Views: 56 		1762416000 56
Description: A Garrett mm9 figure 1
Author: allygarrett
Session Name: mm9 Figure 1 AGarrett
Genome Assembly: mm9
Creation Date: 2025-11-06
Views: 71 		1762416000 71
Description: in class 11/06
Author: lgunter15
Session Name: mm9_gunter_public
Genome Assembly: mm9
Creation Date: 2025-11-06
Views: 91 		1762416000 91
Description: mm9 Trpm1 viewing DNase1 Hypersensitivity
Author: LucaDooley
Session Name: mm9 Trpm1 DH1
Genome Assembly: mm9
Creation Date: 2025-11-06
Views: 50 		1762416000 50
Description: rho DNaseI Hs
Author: Will42ka
Session Name: mm9_rho_encode
Genome Assembly: mm9
Creation Date: 2025-11-06
Views: 47 		1762416000 47
Description: Mouse Trpm1 Gene with UCSC Genes track w/ splice variants enabled and zoomed out 1.5x
Author: messicbr
Session Name: mm9 Trpm1_481BM
Genome Assembly: mm9
Creation Date: 2025-11-06
Views: 53 		1762416000 53
Description: Mouse Rho gene with day 1, week 1, and week 8 DNase 1 HS
Author: Elizabeth McLaughlin
Session Name: mm9 RHO DNase1 HS
Genome Assembly: mm9
Creation Date: 2025-11-06
Views: 47 		1762416000 47
Description: mm9 retina mouse gene
Author: MadisonTesnow
Session Name: mm9 retina mouse gene figure 1 Madison Tesnow
Genome Assembly: mm9
Creation Date: 2025-11-06
Views: 55 		1762416000 55
Description: mm9 Rhodopsin Gene looking at changes from day 1 to 8 weeks for mouse
Author: messicbr
Session Name: mm9 RHO_481BM
Genome Assembly: mm9
Creation Date: 2025-11-06
Views: 44 		1762416000 44
Description: mouse RHO gene
Author: oliviakloc
Session Name: mm9RHO
Genome Assembly: mm9
Creation Date: 2025-11-06
Views: 47 		1762416000 47
Description: mess up on discription of last one
Author: Caesaram
Session Name: mm9 rho dnase real
Genome Assembly: mm9
Creation Date: 2025-11-06
Views: 49 		1762416000 49
Description: in class rho mm9 mouse aw
Author: averywitt
Session Name: mm9 rho aw
Genome Assembly: mm9
Creation Date: 2025-11-06
Views: 55 		1762416000 55
Description: Mouse rho
Author: sronalds
Session Name: Fall25_MouseMM9_RHO_BIO581_Group6
Genome Assembly: mm9
Creation Date: 2025-11-06
Views: 53 		1762416000 53
Description: mm9 Rho DNase1H 11/6/25 ED
Author: Delleeb
Session Name: mm9 Rho DNase1H Data 11/6/25
Genome Assembly: mm9
Creation Date: 2025-11-06
Views: 50 		1762416000 50
Description: mm9 Trpm1 gene
Author: Elizabeth Callis
Session Name: mm9 Trpm1 gene
Genome Assembly: mm9
Creation Date: 2025-11-06
Views: 48 		1762416000 48
Description: mm9 Trpm1 DNase1 11/6/25 Ed
Author: Delleeb
Session Name: mm9 Trpm1 DNase1H Data 11/6/25
Genome Assembly: mm9
Creation Date: 2025-11-06
Views: 58 		1762416000 58
Description: mm9 RHO viewing DNaseI Hypersensitivity
Author: LucaDooley
Session Name: mm9 RHO DH1
Genome Assembly: mm9
Creation Date: 2025-11-06
Views: 41 		1762416000 41
Description: DNase mouse genome
Author: Elizabeth Callis
Session Name: mm9 DNase
Genome Assembly: mm9
Creation Date: 2025-11-06
Views: 47 		1762416000 47
Description: Custom Track for Quiz 8 in northeastern 6310 Fall 2025.
Author: fengkailin
Session Name: fk6310q8
Genome Assembly: hg38
Creation Date: 2025-11-03
Views: 127 		1762156800 127
Description: CUSTOM TRACKS
Author: mollina
Session Name: hg38_MOLLINA
Genome Assembly: hg38
Creation Date: 2025-11-02
Views: 78 		1762070400 78
Description: For Module 08 Quiz: test1.bed description: spacer Blue ticks every 10000 bases bed 3 chr22: even Red ticks every 100 bases, skip 100 bed 3 chr22:
Author: ham.is
Session Name: module08assignment
Genome Assembly: hg38
Creation Date: 2025-11-01
Views: 66 		1761984000 66
Description: assignment 8 test.bed annotation of chr 22
Author: vdanthur1
Session Name: quiz8
Genome Assembly: hg38
Creation Date: 2025-10-30
Views: 57 		1761811200 57
Description: the genes are left in BED mode
Author: customtracks
Session Name: hg38_bed
Genome Assembly: hg38
Creation Date: 2025-10-29
Views: 62 		1761724800 62
Description: bigwig profiles for Zmynd8 study.
Author: gongwx
Session Name: Zmynd8_mm10
Genome Assembly: mm10
Creation Date: 2025-10-29
Views: 116 		1761724800 116
Description: Test
Author: marcwayn
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2025-10-27
Views: 168 		1761552000 168
Description: a
Author: gregfar
Session Name: CYP2D6_UMAP24_repeats
Genome Assembly: hg38
Creation Date: 2025-10-24
Views: 67 		1761292800 67
Description: CSNK2A1_UMAP24_repeats
Author: gregfar
Session Name: CSNK2A1_UMAP24_repeats2
Genome Assembly: hg38
Creation Date: 2025-10-24
Views: 40 		1761292800 40
Description: a
Author: gregfar
Session Name: CSNK2A1_UMAP24_repeats
Genome Assembly: hg38
Creation Date: 2025-10-24
Views: 38 		1761292800 38
Description: CSNK2A1
Author: gregfar
Session Name: CSNK2A1_UMAP24
Genome Assembly: hg38
Creation Date: 2025-10-22
Views: 137 		1761120000 137
Description: bloublou
Author: Michelp
Session Name: Marlene_01
Genome Assembly: sacCer3
Creation Date: 2025-10-20
Views: 77 		1760947200 77
Description: A study of the bizarre naked mole rat shows that the animals have evolved a DNA repair mechanism that could explain their longevity. Naked mole-rats can live for up to 30-40 years, which is roughly ten times longer than typical rats, which live only 1–3 years. When a cell senses damage, one of the substances it produces is a protein called c-GAS. Unlike human cGAS, which inhibits DNA repair by homologous recombination in the nucleus, the naked mole rat enzyme has four amino acid changes that allow it to enhance DNA repair, thus delaying aging and enhancing lifespan, the study concludes. The four specific amino acid residue substitutions are located within the C-terminal domain of the cGAS protein. This amino acid alteration enabled naked mole-rat cGAS to prolong its retention on chromatin in the wake of DNA damage by modulating its ubiquitination status -which usually signals a protein is ready to be degraded. The changes altered its interaction with segregase P97, which breaks down unneeded or damaged proteins through proteolysis, allowing cGAS to participate in further DNA repair mechanisms. Experimentally reverting these four amino acid residues abolished these protective effects in naked mole rats. The four amino acids in conferring prolonged chromatin binding (E, Glu; S, Ser; T, Thr; Y, Tyr) and their numbered location on the cGAS protein are S463, E511, Y527, T530. Phylogenetic analysis of cGAS protein sequences across three major rodent clades revealed that the four amino acid changes evolved gradually within the naked mole-rat, but are not observed in other rodents or long-lived mammalian species outside Rodentia. Two exceptions include the gray squirrel (Sciurus carolinensis) and the blind mole-rat (Spalax galili), which have two of the four mutations. Supplemental data Fig. S2. C shows the multiple amino acid sequence alignment of cGAS C3 region among NM-R, rat, mouse, and human. Human mutations for cGAS would be D431S (S463), K479E (E511), L495Y (Y527), K498T (T530). The following HGVS notation can be searched in the UCSC Genome Browser to find these spots: NP_612450.2(CGAS):p.D431S NP_612450.2(CGAS):p.K479E NP_612450.2(CGAS):p.L495Y NP_612450.2(CGAS):p.K498T
Author: brianlee
Session Name: Naked_Mole_Rat_Mutations
Genome Assembly: hg38
Creation Date: 2025-10-14
Views: 181 		1760428800 181
Description: BIO481 Q2 9/7/26
Author: cox2aa
Session Name: hg38 RHO 9/7/26 Q2
Genome Assembly: hg38
Creation Date: 2026-09-07
Views: 10 		1788768000 10
Description: BIO481 Lab Quiz 1 9/7/26
Author: cox2aa
Session Name: ACox hg18 RHO
Genome Assembly: hg38
Creation Date: 2026-09-07
Views: 19 		1788768000 19
Description: this is figure 1
Author: lgunter15
Session Name: HTT_simple_repeates
Genome Assembly: hg38
Creation Date: 2025-10-09
Views: 56 		1759996800 56
Description: this is the HTT gene with a zoomed view of the CAG repeats in the gene that cause huntington's.
Author: lgunter15
Session Name: HTT_repeats
Genome Assembly: hg38
Creation Date: 2025-10-09
Views: 74 		1759996800 74
Description: assignment for 10/9 with highlighted region of the repeat sequence
Author: katelynnmenjivar
Session Name: hg38 hw 10/9 KM
Genome Assembly: hg38
Creation Date: 2025-10-09
Views: 38 		1759996800 38
Description: Figure 1
Author: allygarrett
Session Name: hg38 - F1
Genome Assembly: hg38
Creation Date: 2025-10-08
Views: 98 		1759910400 98
Description: Figure 2
Author: allygarrett
Session Name: hg38 - F2
Genome Assembly: hg38
Creation Date: 2025-10-08
Views: 77 		1759910400 77
Description: hg38 HTT gene exon 1
Author: Elizabeth Callis
Session Name: hg38 HTT gene exon 1
Genome Assembly: hg38
Creation Date: 2025-10-08
Views: 48 		1759910400 48
Description: HTT in class assignment due 10/9
Author: averywitt
Session Name: HTT in class
Genome Assembly: hg38
Creation Date: 2025-10-08
Views: 47 		1759910400 47
Description: Looking for simple repeats on Chr 4 of HTT gene.
Author: SamiraL
Session Name: HTT with “Simple Repeats” figure 1
Genome Assembly: hg38
Creation Date: 2025-10-08
Views: 69 		1759910400 69
Description: HTT Gene Zoomed in on CAG repeat region
Author: messicbr
Session Name: hg38 HTT_ZoomedIN
Genome Assembly: hg38
Creation Date: 2025-10-08
Views: 43 		1759910400 43
Description: HTT Gene with GENCODE V46 and Simple Repeats
Author: messicbr
Session Name: hg38 HTT_ZoomedOut
Genome Assembly: hg38
Creation Date: 2025-10-08
Views: 46 		1759910400 46
Description: Simple Repeats track in squish view shows multiple repeat elements distributed throughout the HTT gene, including CAG repeat regions implicated in Huntington’s disease.
Author: ashelhorse
Session Name: HTTFig1
Genome Assembly: hg38
Creation Date: 2025-10-07
Views: 48 		1759824000 48
Description: This snapshot displays the CAG repeat region in the first exon of HTT. The Simple Repeats track reports about 21 CAG repeats, and the Short Match tool highlights tandem CAG sequences. Because this number is well below the disease threshold (>39 repeats), the reference genome individual would not be expected to develop Huntington’s disease.
Author: ashelhorse
Session Name: HTTFig2
Genome Assembly: hg38
Creation Date: 2025-10-07
Views: 49 		1759824000 49
Description: Figure 2
Author: sronalds
Session Name: Fall25_HTTgene_Group6_BIO581_Fig2
Genome Assembly: hg38
Creation Date: 2025-10-07
Views: 53 		1759824000 53
Description: creating custom track for mod 8 quiz
Author: zanedeso
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2026-03-10
Views: 256 		1773129600 256
Description: HTT gene repeat polymorphism associated with Huntington’s disease
Author: ashelhorse
Session Name: HTT
Genome Assembly: hg38
Creation Date: 2025-10-07
Views: 64 		1759824000 64
Description: HTT gene overview for class
Author: LucaDooley
Session Name: hg38 HTT Gene
Genome Assembly: hg38
Creation Date: 2025-10-07
Views: 46 		1759824000 46
Description: Human HTT gene annotated
Author: Caesaram
Session Name: hg38 HTT
Genome Assembly: hg38
Creation Date: 2025-10-07
Views: 37 		1759824000 37
Description: Before class quiz
Author: sronalds
Session Name: Fall25_HTTgene_Quiz_BIO581
Genome Assembly: hg38
Creation Date: 2025-10-07
Views: 46 		1759824000 46
Description: HTT Gene - Allison Garrett
Author: allygarrett
Session Name: hg38-HTT
Genome Assembly: hg38
Creation Date: 2025-10-07
Views: 53 		1759824000 53
Description: Figure 1
Author: sronalds
Session Name: Fall25_HTT_Group6_BIO581_Fig1
Genome Assembly: hg38
Creation Date: 2025-10-07
Views: 55 		1759824000 55
Description: HTT gene with view of simple repeats quiz for 10/07
Author: lgunter15
Session Name: hg38_HTT
Genome Assembly: hg38
Creation Date: 2025-10-07
Views: 42 		1759824000 42
Description: HTT
Author: shifflzk
Session Name: hg38. HTT
Genome Assembly: hg38
Creation Date: 2025-10-06
Views: 49 		1759737600 49
Description: HTT Gene with Genecode V32 and Simple Repeats tracks
Author: messicbr
Session Name: hg38 HTT Gene
Genome Assembly: hg38
Creation Date: 2025-10-06
Views: 38 		1759737600 38
Description: 10/03 hw assignment
Author: katelynnmenjivar
Session Name: hg38 hw 10/3
Genome Assembly: hg38
Creation Date: 2025-10-06
Views: 44 		1759737600 44
Description: Looking at Huntington’s disease CHR 4.
Author: SamiraL
Session Name: SL Huntington’s disease Hg38/13
Genome Assembly: hg38
Creation Date: 2025-10-06
Views: 46 		1759737600 46
Description: HW 10/6 HTT gene
Author: averywitt
Session Name: hg38 HTT gene AW
Genome Assembly: hg38
Creation Date: 2025-10-06
Views: 25 		1759737600 25
Description: Displays two custom BED tracks (spacer and even) on chr22:20,100,000–20,100,100. Blue ticks every 10 kb, red ticks every 100 bp.
Author: Sayedahmed.a
Session Name: hg38-test_bed_assignment
Genome Assembly: hg38
Creation Date: 2025-10-27
Views: 60 		1761552000 60
Description: the HTT gene in the human hg38 genome browser.
Author: Elizabeth Callis
Session Name: hg38 HTT gene
Genome Assembly: hg38
Creation Date: 2025-10-03
Views: 47 		1759478400 47
Description: This UCSC public session provides interactive visualization of the complete ChIP-seq and bulk ATAC-seq datasets presented in Mariner et al., manuscript submitted to Nucleic Acids Research.
Author: mariamafau
Session Name: Mariner_NAR_2025
Genome Assembly: mm10
Creation Date: 2025-09-23
Views: 112 		1758614400 112
Description: primates have similar/different chromosome fusion events to the human-chimp fusion relationship
Author: ashelhorse
Session Name: human-chimp fusion relationship
Genome Assembly: hg38
Creation Date: 2025-09-16
Views: 150 		1758009600 150
Description: hg38 chr2 expanded synteny
Author: allygarrett
Session Name: hg38 chr2 expanded synteny
Genome Assembly: hg38
Creation Date: 2025-09-16
Views: 66 		1758009600 66
Description: Genome Browser Assignment
Author: SamiraL
Session Name: Ridley Ch2 Species Chimps & other 6
Genome Assembly: hg38
Creation Date: 2025-09-16
Views: 52 		1758009600 52
Description: hg38 vs primates chr2 9/16/25 Madison Tesnow
Author: MadisonTesnow
Session Name: hg38 vs primates chr2 9/16/25 Madison Tesnow
Genome Assembly: hg38
Creation Date: 2025-09-16
Views: 56 		1758009600 56
Description: 7 primate comparison to human chr2
Author: averywitt
Session Name: chr2 compared to 7 primate AW
Genome Assembly: hg38
Creation Date: 2025-09-16
Views: 62 		1758009600 62
Description: Comparison of human chromosome 2 with chromosomes from bonobos, chimpanzees, gorillas, orangutans, proboscis monkeys, and golden snub-nosed monkeys.
Author: messicbr
Session Name: Human-Primate Comparison
Genome Assembly: hg38
Creation Date: 2025-09-16
Views: 48 		1758009600 48
Description: more chromosome comparison
Author: lgunter15
Session Name: figure2_chimpChr2
Genome Assembly: hg38
Creation Date: 2025-09-16
Views: 43 		1758009600 43
Description: human genome, ridley ch2
Author: lgunter15
Session Name: figure1_chimpChr2
Genome Assembly: hg38
Creation Date: 2025-09-16
Views: 40 		1758009600 40
Description: In class Ridley Ch2 Fig. 2.
Author: LucaDooley
Session Name: hg38 Chimp Fig 2.
Genome Assembly: hg38
Creation Date: 2025-09-16
Views: 52 		1758009600 52
Description: Genome Browser assignment
Author: SamiraL
Session Name: Ridley Ch2 Species
Genome Assembly: hg38
Creation Date: 2025-09-16
Views: 41 		1758009600 41
Description: human chr2 vs that of other primates
Author: Elizabeth Callis
Session Name: hg38 human-chimp chr2 with other primates
Genome Assembly: hg38
Creation Date: 2025-09-16
Views: 48 		1758009600 48
Description: Human chromosome 2 compared to 7 primates
Author: Caesaram
Session Name: hg38 chr2 primates
Genome Assembly: hg38
Creation Date: 2025-09-16
Views: 34 		1758009600 34
Description: Conservation of chromosome 2 between humans and chimps
Author: Caesaram
Session Name: hg38 chr 2 chimp
Genome Assembly: hg38
Creation Date: 2025-09-16
Views: 46 		1758009600 46
Description: In class Ridley Ch2 assignment.
Author: LucaDooley
Session Name: hg38 Chimp Fig 1.
Genome Assembly: hg38
Creation Date: 2025-09-16
Views: 37 		1758009600 37
Description: 77
Author: alexandratrias
Session Name: hg38 7 primates.2
Genome Assembly: hg38
Creation Date: 2025-09-16
Views: 52 		1758009600 52
Description: Fall25_Synteny_Group6_BIO581_Fig2
Author: sronalds
Session Name: Fall25_Synteny_Group6_BIO581_Fig2
Genome Assembly: hg38
Creation Date: 2025-09-16
Views: 38 		1758009600 38
Description: 3
Author: alexandratrias
Session Name: hg38 chimp3
Genome Assembly: hg38
Creation Date: 2025-09-16
Views: 41 		1758009600 41
Description: hg38 chr3 chimp synteny
Author: allygarrett
Session Name: hg38 chr3 chimp synteny
Genome Assembly: hg38
Creation Date: 2025-09-16
Views: 40 		1758009600 40
Description: hg38 vs chimp chr2 9/16/25 Madison Tesnow
Author: MadisonTesnow
Session Name: hg38 vs chimp chr2 9/16/25 Madison Tesnow
Genome Assembly: hg38
Creation Date: 2025-09-16
Views: 39 		1758009600 39
Description: Fall25_Synteny_Group6_BIO581_Fig1
Author: sronalds
Session Name: Fall25_Synteny_Group6_BIO581_Fig1
Genome Assembly: hg38
Creation Date: 2025-09-16
Views: 34 		1758009600 34
Description: chromosome 2 with added species for comparison
Author: katelynnmenjivar
Session Name: chromosome 2 in comparison to other species
Genome Assembly: hg38
Creation Date: 2025-09-16
Views: 46 		1758009600 46
Description: 2
Author: alexandratrias
Session Name: hg38 chimp2
Genome Assembly: hg38
Creation Date: 2025-09-16
Views: 37 		1758009600 37
Description: chromosome 2 with highlighted region
Author: katelynnmenjivar
Session Name: chromosome 2
Genome Assembly: hg38
Creation Date: 2025-09-16
Views: 57 		1758009600 57
Description: Human Chromosome 3 in comparison to chimp chromosomes
Author: messicbr
Session Name: Human-Chimp Comparison
Genome Assembly: hg38
Creation Date: 2025-09-16
Views: 44 		1758009600 44
Description: human chr2 vs chimp
Author: Elizabeth Callis
Session Name: hg38 human v chimp chr2
Genome Assembly: hg38
Creation Date: 2025-09-16
Views: 34 		1758009600 34
Description: 7
Author: alexandratrias
Session Name: hg38: 7 primates
Genome Assembly: hg38
Creation Date: 2025-09-16
Views: 38 		1758009600 38
Description: chr 2 kaya w
Author: Will42ka
Session Name: hg38 7 species human chr2 fusion
Genome Assembly: hg38
Creation Date: 2025-09-16
Views: 45 		1758009600 45
Description: 7 primate genomes comparisons
Author: Delleeb
Session Name: hg38 chromosome 2 7 genomes
Genome Assembly: hg38
Creation Date: 2025-09-16
Views: 48 		1758009600 48
Description: chr 2
Author: Will42ka
Session Name: hg38 chimp human chr2
Genome Assembly: hg38
Creation Date: 2025-09-16
Views: 43 		1758009600 43
Description: Human CRX gene mutations
Author: allygarrett
Session Name: hg38 CRX gene
Genome Assembly: hg38
Creation Date: 2025-09-11
Views: 44 		1757577600 44
Description: CRX to see annotations and mutatuions
Author: lgunter15
Session Name: CRX
Genome Assembly: hg38
Creation Date: 2025-09-11
Views: 40 		1757577600 40
Description: for in class assignment
Author: averywitt
Session Name: Avery CRX practice
Genome Assembly: hg38
Creation Date: 2025-09-11
Views: 48 		1757577600 48
Description: CRX gene isoforms
Author: sronalds
Session Name: Fall25_CRX gene isoforms_BIO581_Group6
Genome Assembly: hg38
Creation Date: 2025-09-11
Views: 57 		1757577600 57
Description: CRX gene w uniprot
Author: Will42ka
Session Name: hg38 CRX
Genome Assembly: hg38
Creation Date: 2025-09-11
Views: 43 		1757577600 43
Description: CRX gene and mutations
Author: Caesaram
Session Name: Hg38 Crx 9/11
Genome Assembly: hg38
Creation Date: 2025-09-11
Views: 49 		1757577600 49
Description: bitter tasting alleles
Author: lgunter15
Session Name: TAS2R38
Genome Assembly: hg19
Creation Date: 2025-09-09
Views: 74 		1757404800 74
Description: SNP with OMIM in hg19
Author: Elizabeth Callis
Session Name: hg19 SNP 1
Genome Assembly: hg19
Creation Date: 2025-09-09
Views: 48 		1757404800 48
Description: hg19 TAS2R38
Author: Delleeb
Session Name: hg19 TAS2R38 ED
Genome Assembly: hg19
Creation Date: 2025-09-09
Views: 46 		1757404800 46
Description: hg19 TAS2R38
Author: allygarrett
Session Name: hg19 TAS2R38
Genome Assembly: hg19
Creation Date: 2025-09-09
Views: 39 		1757404800 39
Description: TAS2R38
Author: sronalds
Session Name: Fall25_TAS2R38_BIO581_Group6
Genome Assembly: hg19
Creation Date: 2025-09-09
Views: 45 		1757404800 45
Description: SNP in hg19
Author: Elizabeth Callis
Session Name: hg19 SNP
Genome Assembly: hg19
Creation Date: 2025-09-09
Views: 43 		1757404800 43
Description: Genomics
Author: sronalds
Session Name: Fall25_Dinoflagellates_Group6
Genome Assembly: hg38
Creation Date: 2025-09-15
Views: 50 		1757923200 50
Description: Fall25 Yeast BIO481 group2
Author: allygarrett
Session Name: Fall25 Yeast BIO481 group2
Genome Assembly: sacCer3
Creation Date: 2025-09-03
Views: 74 		1756886400 74
Description: Rho gene
Author: LucaDooley
Session Name: hg19 RHO
Genome Assembly: hg19
Creation Date: 2025-09-02
Views: 54 		1756800000 54
Description: hghlights and pack view things
Author: Will42ka
Session Name: hg19 rho w highlights
Genome Assembly: hg19
Creation Date: 2025-09-02
Views: 67 		1756800000 67
Description: hg19 rho
Author: Will42ka
Session Name: hg19 rho
Genome Assembly: hg19
Creation Date: 2025-09-02
Views: 32 		1756800000 32
Description: Conservation of RHO exons 2 and 3 compared with mouse, chicken, and zebrafish
Author: Caesaram
Session Name: hg19 RHO Cons
Genome Assembly: hg19
Creation Date: 2025-09-02
Views: 41 		1756800000 41
Description: RHO gene quiz #2
Author: ashelhorse
Session Name: hg19 RHO #2
Genome Assembly: hg19
Creation Date: 2025-09-02
Views: 52 		1756800000 52
Description: Human RHO gene with OMIM track
Author: Caesaram
Session Name: hg19 RHO
Genome Assembly: hg19
Creation Date: 2025-09-02
Views: 39 		1756800000 39
Description: hg19 RHO quiz 2 Ally Garrett
Author: allygarrett
Session Name: hg19 RHO Quiz 2
Genome Assembly: hg19
Creation Date: 2025-09-02
Views: 49 		1756800000 49
Description: hg19 RHO
Author: allygarrett
Session Name: hg19 RHO
Genome Assembly: hg19
Creation Date: 2025-09-02
Views: 48 		1756800000 48
Description: Quiz 2
Author: sronalds
Session Name: hg19_Q2
Genome Assembly: hg19
Creation Date: 2025-09-02
Views: 52 		1756800000 52
Description: hg19 RHO
Author: sronalds
Session Name: hg19 RHO
Genome Assembly: hg19
Creation Date: 2025-09-02
Views: 38 		1756800000 38
Description: RHO gene with OMIM Alleles
Author: ashelhorse
Session Name: hg19 RHO
Genome Assembly: hg19
Creation Date: 2025-09-01
Views: 40 		1756713600 40
Description: Quiz 2
Author: SamiraL
Session Name: HG19 RHO QUIZ 2
Genome Assembly: hg19
Creation Date: 2025-09-01
Views: 42 		1756713600 42
Description: pdf v
Author: zshiff
Session Name: hg19 pdf v
Genome Assembly: hg19
Creation Date: 2025-09-01
Views: 51 		1756713600 51
Description: hg19 RHO
Author: zshiff
Session Name: hg19 RHO
Genome Assembly: hg19
Creation Date: 2025-09-01
Views: 64 		1756713600 64
Description: RHO gene for quiz 2
Author: averywitt
Session Name: hg19 RHO quiz 2
Genome Assembly: hg19
Creation Date: 2025-09-01
Views: 32 		1756713600 32
Description: hg19 RHO gene for quiz 1
Author: averywitt
Session Name: hg19 RHO
Genome Assembly: hg19
Creation Date: 2025-09-01
Views: 41 		1756713600 41
Description: Rhodopsin gene view with highlights on exons 2 and 3
Author: messicbr
Session Name: hg19 v2
Genome Assembly: hg19
Creation Date: 2025-09-01
Views: 49 		1756713600 49
Description: View of the Rhodopsin gene with OMIM track
Author: messicbr
Session Name: hg19 RHO
Genome Assembly: hg19
Creation Date: 2025-09-01
Views: 48 		1756713600 48
Description: quiz 2 submission
Author: lgunter15
Session Name: hg19_quiz2
Genome Assembly: hg19
Creation Date: 2025-08-31
Views: 38 		1756627200 38
Description: hg19 RHO part 2 for quiz #2
Author: katelynnmenjivar
Session Name: hg19 RHO Part 2 KM
Genome Assembly: hg19
Creation Date: 2025-08-31
Views: 33 		1756627200 33
Description: RHO hg19 done by Lilymae Gunter for Quiz assignment
Author: lgunter15
Session Name: hg19 RHO
Genome Assembly: hg19
Creation Date: 2025-08-31
Views: 57 		1756627200 57
Description: h19 RHO quiz 1 practice
Author: katelynnmenjivar
Session Name: hg19 RHO
Genome Assembly: hg19
Creation Date: 2025-08-31
Views: 44 		1756627200 44
Description: quiz 1
Author: alexandratrias
Session Name: hg19 RHO
Genome Assembly: hg19
Creation Date: 2025-08-31
Views: 48 		1756627200 48
Description: Fall25 Yeast BIO481 group#2
Author: MadisonTesnow
Session Name: Fall25 Yeast BIO481 group#2
Genome Assembly: sacCer3
Creation Date: 2025-08-30
Views: 53 		1756540800 53
Description: The yeast activity performed in class
Author: annesophierosa
Session Name: CGEMS yeast AR test
Genome Assembly: sacCer3
Creation Date: 2025-08-28
Views: 52 		1756368000 52
Description: Genomics class
Author: sronalds
Session Name: Fall25 MouseBIO581group6
Genome Assembly: mm10
Creation Date: 2025-08-28
Views: 52 		1756368000 52
Description: Yeast Genomic Browser Activity
Author: SamiraL
Session Name: CGEMS Worm SL Test
Genome Assembly: sacCer3
Creation Date: 2025-08-28
Views: 43 		1756368000 43
Description: bio 481-worm
Author: katelynnmenjivar
Session Name: CGEMS Worm KM test
Genome Assembly: ce11
Creation Date: 2025-08-28
Views: 48 		1756368000 48
Description: C. elegans EDG2
Author: ashelhorse
Session Name: Fall25 Yeast BIO481 group#2
Genome Assembly: sacCer3
Creation Date: 2025-08-28
Views: 45 		1756368000 45
Description: S. cerevisiae yeast genome browser day 1
Author: SamiraL
Session Name: Fall25 Yeast BIO481 group 1
Genome Assembly: sacCer3
Creation Date: 2025-08-28
Views: 39 		1756368000 39
Description: class assignment Group 1 Yeast/Lilymae Gunter
Author: lgunter15
Session Name: Fall25 Yeast BIO481 group1
Genome Assembly: sacCer3
Creation Date: 2025-08-28
Views: 39 		1756368000 39
Description: class work group 1 yeast AW
Author: averywitt
Session Name: Fall25 Yeast BIO481 group#1
Genome Assembly: sacCer3
Creation Date: 2025-08-28
Views: 40 		1756368000 40
Description: Fall25 MouseBIO481 group5
Author: zshiff
Session Name: CGEMS Mouse ZKS Test
Genome Assembly: mm39
Creation Date: 2025-08-28
Views: 49 		1756368000 49
Description: BIO481 C. elegans genome assignment
Author: messicbr
Session Name: Fall2025 Worm BIO481 Group #4
Genome Assembly: ce11
Creation Date: 2025-08-28
Views: 40 		1756368000 40
Description: Fall25 Worm BIO481 group#3
Author: Elizabeth Callis
Session Name: Fall25 Worm BIO481 group#3
Genome Assembly: ce11
Creation Date: 2025-08-28
Views: 142 		1756368000 142
Description: Fall25 C. elegans Bio481 group3
Author: oliviakloc
Session Name: Fall25 Worm Bio481 group3
Genome Assembly: ce11
Creation Date: 2025-08-28
Views: 51 		1756368000 51
Description: Fall 2025 C. elegans Bio 481 Group 3
Author: Elizabeth McLaughlin
Session Name: Fall 2025 Worm Bio 481 Group 3
Genome Assembly: ce11
Creation Date: 2025-08-28
Views: 56 		1756368000 56
Description: Worm group #3
Author: Hailandon
Session Name: Fall25 Worm Bio481 #3
Genome Assembly: ce11
Creation Date: 2025-08-28
Views: 41 		1756368000 41
Description: Kaya C. elegans
Author: Will42ka
Session Name: FALL25 KW Worm Bio481 group4
Genome Assembly: ce11
Creation Date: 2025-08-28
Views: 45 		1756368000 45
Description: MOuse mm39
Author: Caesaram
Session Name: Fall25 MouseBIO481 group #6
Genome Assembly: mm39
Creation Date: 2025-08-28
Views: 54 		1756368000 54
Description: C. elegans ICD-1
Author: Delleeb
Session Name: Emily Delle - Fall25 C.elegans BIO481/581 group4
Genome Assembly: ce11
Creation Date: 2025-08-28
Views: 60 		1756368000 60
Description: Session on Hg38 to interpret SV variants
Author: csauve
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2024-07-23
Views: 300 		1721721600 300
Description: OG is the predominant product of oxidative damage in the genome and has been shown to play an important regulatory role under pathological conditions such as cancer and aging. GOAL-MAP enabled profiling of OG landscape of mouse cells.
Author: KAI_LI
Session Name: Mus_cell_line_OG_map
Genome Assembly: mm10
Creation Date: 2025-10-28
Views: 63 		1761638400 63
Description: OG is the predominant product of oxidative damage in the genome and has been shown to play an important regulatory role under pathological conditions such as cancer and aging. GOAL-MAP enabled profiling of OG landscape of mouse and human cells, revealing the differential distribution of OG modifications and their potential regulatory functions in gene expression.
Author: KAI_LI
Session Name: Huma cell line OG map
Genome Assembly: hg38
Creation Date: 2025-10-28
Views: 73 		1761638400 73
Description: MCB197 Harvard
Author: amandajoyward
Session Name: MCB197-2A-WGBS
Genome Assembly: hg38
Creation Date: 2025-08-18
Views: 100 		1755504000 100
Description: HEK293T_ChIP_sgRNA
Author: lkhwan0929
Session Name: HEK293T_ChIP_sgRNA
Genome Assembly: hg38
Creation Date: 2025-08-21
Views: 84 		1755763200 84
Description: A UCSC session with public ATAC seq data
Author: JaviML98
Session Name: ATAC-seqData
Genome Assembly: hg19
Creation Date: 2025-08-11
Views: 67 		1754899200 67
Description: Zoomed in Exon 1 CAG x7 repeats
Author: Caesaram
Session Name: hg38 HTT CAG
Genome Assembly: hg38
Creation Date: 2025-10-07
Views: 51 		1759824000 51
Description: Custom track data for ChIP-seq results from the research article titled "Identifying membrane-bound transcriptional regulatory proteins from rare but evolutionarily conserved domain combinations" by Muyoung Lee, Yeejin Jang, Qingqing Guo, Jonghwan Kim, and Edward M. Marcotte.
Author: 10myl200
Session Name: mm10, PREB bioChIP-seq
Genome Assembly: mm10
Creation Date: 2026-01-08
Views: 49 		1767859200 49
Description: HP1a_DamID in central brain from Drosophila 3rd instar larvae upon Ago2 mutation or Lam-KD in neurons.
Author: Shevelyov
Session Name: HP1a_DamID in brain upon Ago2mut or Lam-KD in neurons
Genome Assembly: dm3
Creation Date: 2025-08-05
Views: 68 		1754380800 68
Description: Trout Peak chipSeaq, ATACSeaq Functional annotation of regulatory elements in rainbow trout uncovers roles of the epigenome in genetic selection and genome evolution
Author: rafet
Session Name: GCF_013265735.2G
Genome Assembly: hub_6326273_GCF_013265735.2
Creation Date: 2025-09-15
Views: 75 		1757923200 75
Description: hg38 chromosome 2 with chimp genome
Author: Delleeb
Session Name: hg38 chromosome 2
Genome Assembly: hg38
Creation Date: 2025-09-16
Views: 75 		1758009600 75
Description: FigS6 modified from this session.
Author: 429035671
Session Name: Pei_et_al_2025_figS6_UCSC_track
Genome Assembly: hg19
Creation Date: 2025-07-11
Views: 172 		1752220800 172
Description: UCSC track for FigS1
Author: 429035671
Session Name: Pei_et_al_2025_figS1_UCSC_track
Genome Assembly: hg19
Creation Date: 2025-07-11
Views: 163 		1752220800 163
Description: tak
Author: adasjas
Session Name: ReMap-ChIP TFs saMB1_2 hg38
Genome Assembly: hg38
Creation Date: 2026-05-11
Views: 68 		1778486400 68
Description: updated
Author: adasjas
Session Name: ReMap-ChIP TFs sa3 updated
Genome Assembly: hg19
Creation Date: 2026-05-11
Views: 40 		1778486400 40
Description: OG is the predominant product of oxidative damage in the genome and has been shown to play an important regulatory role under pathological conditions such as cancer and aging. Our studies developed a new genome-wide single-base OG sequencing technology and provided a key resource for clarifying the role of OG in aging.
Author: KAI_LI
Session Name: Mouse_tissue_OG_landscape
Genome Assembly: mm10
Creation Date: 2025-10-28
Views: 55 		1761638400 55
Description: T2D_elizabeth
Author: Elizabeth Alatorre
Session Name: T2D_elizabeth
Genome Assembly: hg38
Creation Date: 2025-07-07
Views: 241 		1751875200 241
Description: AD Dark Microproteome
Author: brmiller
Session Name: AD Dark Microproteomet
Genome Assembly: hg38
Creation Date: 2025-04-03
Views: 1084 		1743667200 1084
Description: Multiregion view of 66 MANE Plus Clinical transcripts
Author: AlistairP
Session Name: MANE_PLUS_CLINICAL
Genome Assembly: hg38
Creation Date: 2025-06-25
Views: 170 		1750838400 170
Description: hg38 FoxP2 Conservation (EC)
Author: echen971
Session Name: hg38 FoxP2 Conservation (EC)
Genome Assembly: hg38
Creation Date: 2026-09-02
Views: 10 		1788336000 10
Description: This is the session showing the location and expression of the new junction that might cause frame shift.
Author: dandan_0909
Session Name: hg19_version
Genome Assembly: hg19
Creation Date: 2025-05-28
Views: 811 		1748419200 811
Description: This is the session showing the location and expression of the new junction and NR junctions
Author: dandan_0909
Session Name: hg19_all_new_nr
Genome Assembly: hg19
Creation Date: 2025-06-09
Views: 374 		1749456000 374
Description: This is the session showing the location and expression of the new junction and NR junctions
Author: dandan_0909
Session Name: hg38_all_new_nr
Genome Assembly: hg38
Creation Date: 2025-06-09
Views: 262 		1749456000 262
Description: data from doi: 10.1101/gr.218602.116. Epub
Author: sansamcl
Session Name: danRer10_RT_chr4
Genome Assembly: danRer10
Creation Date: 2025-05-29
Views: 232 		1748505600 232
Description: HEK293T cell lines engineered to express Empty Vector Control (EV_783) or mutant U2 snRNA (MUT_C28U or MUT_UCA). For each cell line there are 3 tracks for the 3 biological replicates, and are ordered and colored based on the cell line. Bigwig files were created for the forward and reverse reads using deeptools (v3.5.6) and read counts were normalized using the inverse of the DEseq2 size factors.
Author: mstevers
Session Name: U2muttracks_groupedcolor
Genome Assembly: hg38
Creation Date: 2025-05-14
Views: 92 		1747209600 92
Description: Public session with custom track
Author: MariaDeluca
Session Name: hg38_wtest.bed
Genome Assembly: hg38
Creation Date: 2025-11-30
Views: 41 		1764489600 41
Description: things
Author: apehkone
Session Name: MOMIC2_LNCAP
Genome Assembly: hg19
Creation Date: 2025-05-11
Views: 538 		1746950400 538
Description: TFs bind to the binding site of sa3
Author: adasjas
Session Name: ReMap-ChIP TFs sa3
Genome Assembly: hg19
Creation Date: 2026-05-07
Views: 55 		1778140800 55
Description: The UCSC session data for the Long-read Genome Sequencing.
Author: Yuki_INOUE
Session Name: Genome-seq Session
Genome Assembly: mm39
Creation Date: 2025-05-05
Views: 478 		1746432000 478
Description: New set of primers as of 7/1/26
Author: chanstew
Session Name: Primers 7/1/2026
Genome Assembly: mm39
Creation Date: 2026-07-01
Views: 61 		1782892800 61
Description: My whole genome sequencing data from October 2024
Author: becca88
Session Name: Rebecca WGS
Genome Assembly: hg38
Creation Date: 2025-04-16
Views: 1033 		1744790400 1033
Description: Runx3 Cut&Run on MNK3 Cells
Author: pattonjt
Session Name: Run3_CR_MNK3
Genome Assembly: mm10
Creation Date: 2025-04-15
Views: 463 		1744704000 463
Description: retina
Author: ALLDEREP
Session Name: mm9MouseRETINA2025
Genome Assembly: mm9
Creation Date: 2025-04-08
Views: 578 		1744099200 578
Description: hg38 Used for primer design to show the variants from dbSNP155, Gnomad, SNPedia and 1000 genome
Author: vvenugopal
Session Name: hg38_primer_design
Genome Assembly: hg38
Creation Date: 2025-04-08
Views: 411 		1744099200 411
Description: e
Author: ALLDEREP
Session Name: hg38MAPTGENE
Genome Assembly: hg38
Creation Date: 2025-04-03
Views: 237 		1743667200 237
Description: e
Author: ALLDEREP
Session Name: hg19RHOCUSTOM
Genome Assembly: hg19
Creation Date: 2025-04-03
Views: 218 		1743667200 218
Description: The CLOCK gene that regulates circadian rhythms, using human genome GRCh38/hg38.
Author: sjacques
Session Name: circadian_for_submission
Genome Assembly: hg38
Creation Date: 2025-04-03
Views: 226 		1743667200 226
Description: dna
Author: Jessra9
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2025-04-11
Views: 222 		1744358400 222
Description: RNA-seq, ChIP-seq and ATAC-seq data in the study "The SAS Chromatin-Remodeling Complex Mediates Inflorescence-Specific Chromatin Accessibility for Transcription Factor Binding".
Author: GuoJ
Session Name: NAR_SAS_sdl_ifl_all_data
Genome Assembly: hub_2660163_GCF_000001735.4
Creation Date: 2025-03-29
Views: 259 		1743235200 259
Description: diseño primers
Author: Paulabm
Session Name: diseño primers
Genome Assembly: hg19
Creation Date: 2025-03-25
Views: 82 		1742889600 82
Description: Exonic enhancers (EEs) are a newly characterized class of dual-function regulatory elements that reside in protein-coding regions yet retain bona fide enhancer activity. In our study, we integrated transcription factor (TF) binding profiles (ReMap), chromatin accessibility data (DNase, ATAC), and high-throughput reporter assays (STARR-seq, luciferase) to show that many exons can act as cis-regulatory modules. These EEs display hallmark epigenomic signatures, often form long-range interactions with promoters, and are sensitive to both nonsynonymous and synonymous mutations. Functional assays, including CRISPR-based silencing, demonstrate their involvement in regulating host and distal genes. Large-scale cancer genomics analyses reveal that EE variants are associated with dysregulated gene expression and clinical outcomes, underscoring their importance in disease. Evolutionary comparisons further indicate that EEs combine deep sequence conservation with lineage-specific innovation, revealing how coding regions can simultaneously encode protein domains and regulatory activities. This UCSC public session provides direct visualization of these findings, featuring our custom track hub: https://remap.univ-amu.fr/storage/public/hubEE/hub.txt. Researchers can explore TF occupancy, open chromatin marks, STARR-seq signals, and EE annotations genome-wide, offering a comprehensive resource to investigate how exons function as both protein-coding and cis-regulatory elements.
Author: Benoit Ballester
Session Name: hg38_ExonEnhancers_gnomAD
Genome Assembly: hg38
Creation Date: 2025-03-21
Views: 595 		1742544000 595
Description: Exonic enhancers (EEs) are a newly characterized class of dual-function regulatory elements that reside in protein-coding regions yet retain bona fide enhancer activity. In our study, we integrated transcription factor (TF) binding profiles (ReMap), chromatin accessibility data (DNase, ATAC), and high-throughput reporter assays (STARR-seq, luciferase) to show that many exons can act as cis-regulatory modules. These EEs display hallmark epigenomic signatures, often form long-range interactions with promoters, and are sensitive to both nonsynonymous and synonymous mutations. Functional assays, including CRISPR-based silencing, demonstrate their involvement in regulating host and distal genes. Large-scale cancer genomics analyses reveal that EE variants are associated with dysregulated gene expression and clinical outcomes, underscoring their importance in disease. Evolutionary comparisons further indicate that EEs combine deep sequence conservation with lineage-specific innovation, revealing how coding regions can simultaneously encode protein domains and regulatory activities. This UCSC public session provides direct visualization of these findings, featuring our custom track hub: https://remap.univ-amu.fr/storage/public/hubEE/hub.txt. Researchers can explore TF occupancy, open chromatin marks, STARR-seq signals, and EE annotations genome-wide, offering a comprehensive resource to investigate how exons function as both protein-coding and cis-regulatory elements.
Author: Benoit Ballester
Session Name: hg19_ExonEnhancers_TCGA
Genome Assembly: hg19
Creation Date: 2025-03-21
Views: 471 		1742544000 471
Description: This public session offers access to a track hub containing 25,000 predicted forebrain enhancers within the hg19 human genome assembly. These enhancers were identified through a DNA-sequence-based prediction pipeline that integrates tissue-specific transcription factor occupancy patterns. Essential for regulating gene expression during brain development, these enhancers were further validated using chromatin marks, DNase hypersensitivity data, GWAS-based SNP data, and in vivo zebrafish models (https://doi.org/10.1002/1873-3468.15030). Additionally, this session includes an extra track for a subset of 2,614 predicted forebrain enhancers, representing a portion of the full set. This subset specifically reveals the binding patterns of the HES5-FOXP2-GATA3 triad, with FOXP2 binding positioned between HES5 and GATA3, helping define the forebrain transcription factor binding syntax (https://doi.org/10.1242/bio.061751). Together, the forebrain enhancer data presented in this public track hub provides a valuable resource for investigating the genetic regulatory mechanisms underlying brain development and related diseases. It also offers a platform for exploring the role of these predicted enhancers in mammalian and primate brain evolution.
Author: abbasiam
Session Name: hg19_Predicted human forebrain enhancers_hg19
Genome Assembly: hg19
Creation Date: 2025-03-20
Views: 413 		1742457600 413
Description: This session give an overview of the human CHD1 gene encoding the clinically relevant E-Cadherin/Cadherin-1 protein. Disease susceptibility is associated with variants in CDH-1 including gastric cancer and lobular breast cancer. Data tracks demonstrating disease-associated alleles, protein domains, and conservation have been included.
Author: renkejhsph
Session Name: hg38 CDH1 gene
Genome Assembly: hg38
Creation Date: 2025-03-20
Views: 202 		1742457600 202
Description: The Kidney Disease Genetic Scorecard is a multitude of multi-omics datasets for the annotation of regulatory variants, encompassing 32 kinds of genetic evidence including ASE, bASA, snASA, Open4Gene links, and coding variants. This strategy enabled us to prioritize 601 genes targeted by both regulatory variants and coding variants, including 161 genes with convergence of two kinds of variants. The details information is available in Liu et al., Science 2025 (https://www.science.org/doi/full/10.1126/science.adp4753).
Author: hongbo919
Session Name: Kidney.Disease.Genetic.Scorecard
Genome Assembly: hg19
Creation Date: 2024-07-03
Views: 3962 		1719993600 3962
Description: 1 ZFP36L2 (zinc finger protein 36 like 2, C3H type-ZFP) is an RNA-binding protein targeting transcripts rich in adenine-uridine elements (AREs). Previous transcriptomic analysis suggested that ZFP36L2 displays a distinct transcript preference, depending on the tissue of expression. However, this analysis was restricted to a few tissues. Here, we collected RNA-seq data in six tissues and detected a remarkable transcript selectivity. Given that ZFP36L2 accelerates the degradation of specific ARE-transcripts upon binding, we obtained differential expression transcriptomic data on a Zfp36l2 knock-out mouse model to delve into the mechanisms governing this tissue-specific targeting. Transcriptomic analyzes of up regulated ARE-transcripts in lung, liver, bone marrow, spleen, kidney, and ovary of the Zfp36l2-deficient mouse confirmed that there is high tissue preference in ZFP36L2 targets. We observed only one common up regulated gene, Apol11b, among these six different tissues. However, we do observe common trends, specifically an enrichment in protein coding genes in the up regulated genes, consistent with these RBP primarily targeting genes on their 3’ UTRs. Interestingly, we observed a significant increase in the proportion of IG (immunoglobulin) genes being up regulated. We further performed eCLIP (Enhanced Cross-Linking&ImmunoPreciptation) on a mouse cell line, MLTC-1 cells, to identify direct binding sites of ZFP36L2. AU-Rich Element score (AREscore) analysis revealed enrichment in both up regulated genes and eCLIP peaks, although some differences were observed in flanking residue composition. Our findings provide new insights into the intricate regulatory network orchestrated by ZFP36L2, opening avenues for exploring its potential roles in different tissues.
Author: gsgeorge
Session Name: Zfp36l2_mm10_eclip_peaks
Genome Assembly: mm10
Creation Date: 2025-03-27
Views: 226 		1743062400 226
Description: Module 08 test.bed
Author: froemming.m
Session Name: froemming.m_mod_8
Genome Assembly: hg38
Creation Date: 2025-03-10
Views: 703 		1741593600 703
Description: For CNV analysis
Author: HGSalk
Session Name: CNV
Genome Assembly: hg19
Creation Date: 2025-03-06
Views: 399 		1741248000 399
Description: mm39 Blue opsin F2-R2 amplicon (#386-387) for BS seq
Author: renkejhsph
Session Name: mm39 Blue opsin F2-R2 amplicon (#386-387)
Genome Assembly: mm39
Creation Date: 2025-03-04
Views: 480 		1741075200 480
Description: It is tracked by samples and treatment groups. Some differentially accessible peaks highlighted.Custom gtf file with transcript ID, gene names, gene ID
Author: Pengxin Yang
Session Name: pig_BCG_ATAC_filtered_by_sample_and_merged_custom_gtf
Genome Assembly: susScr11
Creation Date: 2025-03-03
Views: 399 		1740988800 399
Description: NSD1 truncating variants
Author: michel.guipponi@hug.ch
Session Name: hg38_NSD1_Truncating
Genome Assembly: hg38
Creation Date: 2025-03-02
Views: 334 		1740902400 334
Description: Why don't humans have tails?
Author: michel.guipponi@hug.ch
Session Name: hg38_TBXT
Genome Assembly: hg38
Creation Date: 2025-03-02
Views: 208 		1740902400 208
Description: NSD1 missense hot-spot
Author: michel.guipponi@hug.ch
Session Name: hg38_NSD1_missense
Genome Assembly: hg38
Creation Date: 2025-03-02
Views: 244 		1740902400 244
Description: Human RHO gene
Author: scarpara
Session Name: hg38 RHO RS 2
Genome Assembly: hg38
Creation Date: 2026-09-07
Views: 8 		1788768000 8
Description: E2F1 binding site on genome depending on SETD6
Author: Gizem
Session Name: E2F1 chip seq
Genome Assembly: hg38
Creation Date: 2025-02-27
Views: 290 		1740643200 290
Description: It has tracks by samples and by treatment groups
Author: Pengxin Yang
Session Name: pig_BCG_ATAC_filtered_by_sample_and_merged
Genome Assembly: susScr11
Creation Date: 2025-02-27
Views: 214 		1740643200 214
Description: ALDH2 and alcohol intolerance in East Asian populations
Author: michel.guipponi@hug.ch
Session Name: hg38_ALDH2
Genome Assembly: hg38
Creation Date: 2025-03-02
Views: 251 		1740902400 251
Description: Each bam file was filtered in the identified 92226 peaks.
Author: Pengxin Yang
Session Name: pig_BCG_ATAC_filtered_by_sample
Genome Assembly: susScr11
Creation Date: 2025-02-26
Views: 307 		1740556800 307
Description: mTEClo vs mTEChi anti-P53 CUT&RUN from Gamble et al. 2025
Author: ngamble
Session Name: antiP53_CUTRUN_mTECs
Genome Assembly: mm10
Creation Date: 2025-02-25
Views: 323 		1740470400 323
Description: A few DAPs highlighted
Author: Pengxin Yang
Session Name: pig_BCG_project_ATAC _highlight
Genome Assembly: susScr11
Creation Date: 2025-02-17
Views: 566 		1739779200 566
Description: peaks visualization for pig BCG project. A few DAPs were highlighted
Author: Pengxin Yang
Session Name: pig_BCG_project_ATAC
Genome Assembly: susScr11
Creation Date: 2025-02-17
Views: 399 		1739779200 399
Description: Machine Learning Prediction of Non-Coding Variant Impact in Cell-Class-Specific Human Retinal Cis-Regulatory Elements Leah S. VandenBosch 1 and Timothy J. Cherry 1,2,3† 1 Center for Developmental Biology and Regenerative Medicine, Seattle Children's Research Institute, Seattle, WA, USA. 2 University of Washington Department of Pediatrics, Seattle, Washington, USA. 3 Brotman Baty Institute for Precision Medicine, Seattle, Washington, USA. † Corresponding Author: timothy.cherry@seattlechildrens.org This public session provides access to a track hub of Variant Impact Prediction (VIP) scores for 39,437 candidate human retinal cis-regulatory elements (CREs) in 18 different cell types and developmental stages from the adult and developing human retina. Non-coding variants in cis-regulatory elements (CREs) like promoters and enhancers contribute to inherited retinal diseases (IRDs) however regulatory variants are typically challenging to interpret and prioritize for follow up studies. To improve identification of variants of interest, we implemented machine learning using a gapped k-mer support vector machine approach (GKM-SVM/deltaSVM) trained on single nucleus ATAC-seq data from specific cell classes and developmental states in the developing and mature human retina. These models demonstrate accuracy over 90% and a high degree of cell class specificity. Variant Impact Prediction Scores (VIPS) nominate specific sequences within candidate CREs, including putative transcription factor (TF) binding motifs, that would likely alter CRE function if mutated. This analysis demonstrates the capacity for singe nucleus-epigenomic data to predict the impact of non-coding sequence variants. It is our hope that these predicted impact scores can assist in identifying and interpreting variants of interest within human retinal cis-regulatory elements.
Author: CherryLab
Session Name: csVISIONS_TrackHub
Genome Assembly: hg38
Creation Date: 2025-02-16
Views: 773 		1739692800 773
Description: rho
Author: ALLDEREP
Session Name: hg19rHONEW
Genome Assembly: hg19
Creation Date: 2025-01-28
Views: 560 		1738051200 560
Description: Abigail Hodges
Author: aehodges
Session Name: hg19 RHO
Genome Assembly: hg19
Creation Date: 2024-08-31
Views: 543 		1725091200 543
Description: single cell bone marrow analysis
Author: marcel
Session Name: BM_scRNA_PB_ID _paper
Genome Assembly: hg38
Creation Date: 2025-01-10
Views: 213 		1736496000 213
Description: mm10_CTCF-CHD7 bigwig signal tracks
Author: jyq_ucsc_2
Session Name: mm10_CTCF-CHD7
Genome Assembly: mm10
Creation Date: 2025-01-08
Views: 750 		1736323200 750
Description: Sept 9th UCSC SNP Quiz Session
Author: jdkomine
Session Name: Sept9 UCSC SNP Quiz Session
Genome Assembly: hg19
Creation Date: 2025-09-09
Views: 51 		1757404800 51
Description: yes
Author: aryanzandi123
Session Name: Core Chromatin State Window
Genome Assembly: hg38
Creation Date: 2024-12-11
Views: 1023 		1733904000 1023
Description: CTCF and SMC1 ChIP-seq data for Crewe et al submission to NAR
Author: Morgan.Crewe
Session Name: NAR_CTCF_SMC1_Data
Genome Assembly: mm10
Creation Date: 2024-12-10
Views: 958 		1733817600 958
Description: Training for visualising transcriptomic data
Author: afrankish
Session Name: longtrec2
Genome Assembly: hg38
Creation Date: 2025-03-02
Views: 277 		1740902400 277
Description: 2/2/25
Author: aehodges
Session Name: hg38//CRX gene
Genome Assembly: hg38
Creation Date: 2025-03-02
Views: 184 		1740902400 184
Description: A new study in Nature reveals how the absence of a small gene segment due to alternative splicing in CPEB4 leads to the deregulation of 200 genes associated with autism spectrum disorders: https://www.nature.com/articles/s41586-024-08289-w An earlier work by the same authors identified this mRNA as a factor in the autism-like phenotype: https://www.nature.com/articles/s41586-018-0423-5 The work took place at IRB Barcelona: https://www.irbbarcelona.org/en/news/scientific/key-breakthrough-autism-pivotal-role-cpeb4-condensates-revealed: “Our results suggest that even small decreases in the percentage of microexon inclusion can have significant effects. This would explain why some individuals without a gene mutation develop idiopathic autism.” UCSC Genome Browser Session
Author: brianlee
Session Name: CPEB4_GCAAGGACATATGGGCGAAGGAGA
Genome Assembly: hg38
Creation Date: 2024-12-05
Views: 340 		1733385600 340
Description: Rearrangements of the 17q24.3 region associated with abnormal phenotypes.
Author: 429035671
Session Name: Pei_et_al_2025_fig5
Genome Assembly: hg19
Creation Date: 2024-12-04
Views: 534 		1733299200 534
Description: Meadow vole hub, published in https://www.biorxiv.org/content/10.64898/2026.03.13.711624v1
Author: mabuelanin
Session Name: meadow_vole_cifi_hifi_hap1
Genome Assembly: hub_7132653_meadow_hap1
Creation Date: 2026-03-06
Views: 73 		1772784000 73
Description: Prairie vole hub, published in https://www.biorxiv.org/content/10.64898/2026.03.13.711624v1
Author: mabuelanin
Session Name: prairie_vole_cifi_hifi_hap1
Genome Assembly: hub_7112633_prairie_hap1
Creation Date: 2026-03-06
Views: 82 		1772784000 82
Description: 12
Author: aryanzandi123
Session Name: Core Chromatin State Window 2.0
Genome Assembly: hg38
Creation Date: 2024-12-11
Views: 293 		1733904000 293
Description: te
Author: aryanzandi123
Session Name: Alternate Repressors and Activators Window
Genome Assembly: hg38
Creation Date: 2024-12-11
Views: 339 		1733904000 339
Description: 15 stae ChromHMM model of MSC,PC,HC based on murine data and on a human ChromHMM model. (Neu et al. 2024)
Author: manuela.wuelling@uni-due.de
Session Name: murine and humanized ChromHMM model
Genome Assembly: mm39
Creation Date: 2024-11-15
Views: 870 		1731657600 870
Description: GFP+ ChIP-Seq data
Author: nimt0001
Session Name: GFP+ ChIP-Seq
Genome Assembly: danRer10
Creation Date: 2024-11-13
Views: 728 		1731484800 728
Description: ATAC-Seq from 8 sorted immune cell populations representing the early lymphoid hematopoietic differentiation cascade along the B cell lineage. Cell populations were isolated from healthy adult human bone marrow precursors and peripheral blood (n=13). A total of 78 samples are analyzed. Additional single-cell ATAC-Seq data from 5 healthy adult human bone marrow, recovering HSC, MPP, LMPP, CLP, cycling pro-B, pro-B, cycling pre-B, and pre-B cells, is analyzed.
Author: TransBioLab
Session Name: hg38_Brex
Genome Assembly: hg38
Creation Date: 2024-11-13
Views: 993 		1731484800 993
Description: MultiRegion chrX 1 156040895 chrY 1 57227415 https://www.jax.org/jax-mice-and-services/ipsc The KOLF2.1J cell line was derived from the HPSI0114i-kolf_2 line through extensive molecular and cellular characterization efforts, including the correction of a pathogenic mutation in ARID2. https://www.hipsci.org/#/lines/HPSI0114i-kolf_2 Biosample: SAMEA2547615 https://www.ebi.ac.uk/biosamples/samples/SAMEA2547615 subject id SAMEA2398402 https://www.ebi.ac.uk/biosamples/samples/SAMEA2398402 Originating cell line seems to have no chrY data. CRAM file /17998_8%235.cram track name=17998_8%235.cram bigDataUrl=http://ftp.sra.ebi.ac.uk/vol1/run/ERR120/ERR1203439/17998_8%235.cram type=bam Session: https://genome.ucsc.edu/s/brianlee/cram_KOLF2
Author: brianlee
Session Name: cram_KOLF2
Genome Assembly: hg38
Creation Date: 2024-11-12
Views: 438 		1731398400 438
Description: Module 08 Assignment
Author: LouisLiu
Session Name: test
Genome Assembly: hg38
Creation Date: 2024-11-12
Views: 328 		1731398400 328
Description: RHO/H1FOO
Author: sofiaterenziani
Session Name: RHO/H1FOO
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 309 		1730966400 309
Description: NRL/CPNE6
Author: sofiaterenziani
Session Name: NRL/CPNE6
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 312 		1730966400 312
Description: GUCA1B/GUCA1A
Author: sofiaterenziani
Session Name: GUCA1B/GUCA1A
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 306 		1730966400 306
Description: PDE6C/RBP4
Author: sofiaterenziani
Session Name: PDE6C/RBP4
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 313 		1730966400 313
Description: mm9_NRL_CPNE6
Author: l.g.altizer
Session Name: mm9_NRL_CPNE6
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 311 		1730966400 311
Description: mm9_CPNE6_NRL
Author: l.g.altizer
Session Name: mm9_CPNE6_NRL
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 314 		1730966400 314
Description: 11/7
Author: aehodges
Session Name: mm9//Nrl gene
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 267 		1730966400 267
Description: mm9_RHO_H1FOO
Author: l.g.altizer
Session Name: mm9_RHO_H1FOO
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 305 		1730966400 305
Description: 11/7
Author: aehodges
Session Name: mm9//Guac1B gene
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 314 		1730966400 314
Description: GUCA1B/GUCA1A
Author: madelinebarlas
Session Name: mm9 GUCA1B/GUCA1A
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 290 		1730966400 290
Description: multiomics
Author: diazacex
Session Name: Multiomics_mm9_wt_Nrl-
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 312 		1730966400 312
Description: NRL/CPNE6
Author: madelinebarlas
Session Name: mm9 NRL/CPNE6
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 308 		1730966400 308
Description: PDE6C/RBP4
Author: madelinebarlas
Session Name: mm9 PDE6C/RBP4
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 302 		1730966400 302
Description: Mouse Retina stuff
Author: ALLDEREP
Session Name: mm9MouseRetina
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 328 		1730966400 328
Description: PDE6C/RBP4
Author: madisonflorenz
Session Name: PDE6C/RBP4
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 294 		1730966400 294
Description: NRL/CPNE6
Author: rchelsea
Session Name: mm9 NRL
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 302 		1730966400 302
Description: RHO/H1FOO
Author: rchelsea
Session Name: mm9 RHO
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 306 		1730966400 306
Description: GUCA1B/GUCA1A
Author: madisonflorenz
Session Name: GUCA1B/GUCA1A
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 288 		1730966400 288
Description: GUCA1B/GUCA1A
Author: rchelsea
Session Name: mm9 GUCA1B
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 294 		1730966400 294
Description: 11/7
Author: aehodges
Session Name: mm9//PDE6C gene
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 277 		1730966400 277
Description: 11/7
Author: aehodges
Session Name: mm9//RHO
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 295 		1730966400 295
Description: PDE6C/RBP4
Author: rchelsea
Session Name: mm9 PDE6C
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 330 		1730966400 330
Description: NRL/CPNE6
Author: madisonflorenz
Session Name: NRL/CPNE6
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 306 		1730966400 306
Description: mm9 wt CBR Nrl-
Author: diazacex
Session Name: mm9_BAM_wt CBR_Nrl-
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 284 		1730966400 284
Description: RHO/H1FOO
Author: madisonflorenz
Session Name: RHO/H1FOO
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 336 		1730966400 336
Description: mm9_GUCA1B_GUCA1A
Author: l.g.altizer
Session Name: mm9_GUCA1B_GUCA1A
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 352 		1730966400 352
Description: GB Multiomics custom data tracks - 3
Author: madisonflorenz
Session Name: GB Multiomics custom data tracks - 3
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 308 		1730966400 308
Description: mm9_CBR_RNA_seq
Author: l.g.altizer
Session Name: mm9_CBR_RNA_seq
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 309 		1730966400 309
Description: wt CBRs Nrl- CBRs
Author: diazacex
Session Name: mm9_wt CBR_Nrl- CBR
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 310 		1730966400 310
Description: CBR regions with extra data
Author: ClaytonFannin
Session Name: mm9 CBR regions with extra data
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 322 		1730966400 322
Description: RHO/H1FOO
Author: madelinebarlas
Session Name: mm9 RHO/H1FOO
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 301 		1730966400 301
Description: GB Multiomics custom data tracks - 2
Author: madisonflorenz
Session Name: GB Multiomics custom data tracks - 2
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 333 		1730966400 333
Description: mm9_NRL/WT
Author: l.g.altizer
Session Name: mm9_NRL/WT
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 309 		1730966400 309
Description: mm9 CRX CBR mRNA
Author: madelinebarlas
Session Name: mm9 CRX CBR mRNA
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 272 		1730966400 272
Description: 11/7/24
Author: aehodges
Session Name: mm9//2nd
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 315 		1730966400 315
Description: mm9 CBR regions
Author: ClaytonFannin
Session Name: mm9 CBR regions
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 298 		1730966400 298
Description: GB Multiomics custom data tracks - 1
Author: madisonflorenz
Session Name: GB Multiomics custom data tracks - 1
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 279 		1730966400 279
Description: 11/7/24
Author: aehodges
Session Name: mm9//1st
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 299 		1730966400 299
Description: mm9 CRX CBR
Author: madelinebarlas
Session Name: mm9 CRX CBR
Genome Assembly: mm9
Creation Date: 2024-11-07
Views: 315 		1730966400 315
Description: UCSC Genome browser features two custom tracks on chromosome 22, the regions from 20,100,000 to 20,140,000. The first track, titled as “spacer,” marks every 10,000 bases with blue ticks. The second track, named “even,” traced with red ticks every 100 bases (by skip 100 bases), with a 100-base interval between each tick. The “even” track shows labels such as : “first,” “second,” and “third.” These tracks illustrates how BED format can be used to visualize specific genomic intervals with determined position.
Author: ankathi.s
Session Name: Module8 assignment
Genome Assembly: hg38
Creation Date: 2024-11-07
Views: 302 		1730966400 302
Description: This UCSC Genome Browser session features two custom tracks on chromosome 22, covering the region from 20,100,000 to 20,140,000. The first track, titled “spacer,” marks every 10,000 bases with blue ticks. The second track, named “even,” uses red ticks every 100 bases, with a 100-base interval between each tick. The “even” track also includes labels for the first three ticks: “first,” “second,” and “third.” These tracks demonstrate how BED format can be used to visualize specific genomic intervals and annotations.
Author: das.arushi
Session Name: Module_8_assignment_hg38
Genome Assembly: hg38
Creation Date: 2024-11-06
Views: 337 		1730880000 337
Description: This session features two custom tracks on chromosome 22 on hg38 assembly, covering the region from 20,100,000 to 20,140,000. The first track, labeled "spacer" marks blue ticks every 10,000 bases. The second track, called "even" displays red ticks at intervals of 100 bases, with a 100-base gap between each tick. Additionally, the "even" track includes labels for the first three ticks: "first," "second," and "third." These custom tracks illustrate how BED format can be used to visualize specific genomic intervals and annotations.
Author: das.raj
Session Name: BINF 6310: Module 8 Assignment
Genome Assembly: hg38
Creation Date: 2024-11-06
Views: 316 		1730880000 316
Description: This session includes two custom tracks on chromosome 22, spanning the region 20100000-20140000. The first track, named 'spacer', displays blue ticks every 10,000 bases. The second track, named 'even', shows red ticks every 100 bases, skipping 100 bases between each tick. The 'even' track also includes labels for the first three ticks: 'first', 'second', and 'third'. These custom tracks demonstrate the use of BED format for visualizing specific genomic intervals and annotations.
Author: Pratham donda
Session Name: Custom Track Assignment
Genome Assembly: hg38
Creation Date: 2024-11-06
Views: 283 		1730880000 283
Description: This is ganesan murugan's session
Author: ganesan.m
Session Name: ganesan_murugan
Genome Assembly: hg38
Creation Date: 2024-11-06
Views: 309 		1730880000 309
Description: PDE6B: macula RNA-seq peripheral retina RNA-seq
Author: diazacex
Session Name: PDE6B
Genome Assembly: hg38
Creation Date: 2024-11-05
Views: 317 		1730793600 317
Description: RNA-seq custom tracks activity - PDE6B
Author: madisonflorenz
Session Name: RNA-seq custom tracks activity - PDE6B
Genome Assembly: hg38
Creation Date: 2024-11-05
Views: 335 		1730793600 335
Description: RNA-seq custom tracks activity - PDE6A
Author: madisonflorenz
Session Name: RNA-seq custom tracks activity - PDE6A
Genome Assembly: hg38
Creation Date: 2024-11-05
Views: 335 		1730793600 335
Description: PDE6A: macula RNA-seq peripheral retina RNA-seq
Author: diazacex
Session Name: PDE6A
Genome Assembly: hg38
Creation Date: 2024-11-05
Views: 325 		1730793600 325
Description: GNAT2: macula RNA-seq peripheral retina RNA-seq
Author: diazacex
Session Name: GNAT2_rec_mac
Genome Assembly: hg38
Creation Date: 2024-11-05
Views: 300 		1730793600 300
Description: GNAT 1: macula RNA-seq periperal retina RNA-seq
Author: diazacex
Session Name: GNAT1_ret_mac
Genome Assembly: hg38
Creation Date: 2024-11-05
Views: 343 		1730793600 343
Description: RNA-seq custom tracks activity - GNAT2
Author: madisonflorenz
Session Name: RNA-seq custom tracks activity - GNAT2
Genome Assembly: hg38
Creation Date: 2024-11-05
Views: 313 		1730793600 313
Description: RNA-seq custom tracks activity - GNAT1
Author: madisonflorenz
Session Name: RNA-seq custom tracks activity - GNAT1
Genome Assembly: hg38
Creation Date: 2024-11-05
Views: 308 		1730793600 308
Description: RHO macula RNA-seq RHO periperal retina RNA-seq
Author: diazacex
Session Name: RHO_ret_mac
Genome Assembly: hg38
Creation Date: 2024-11-05
Views: 306 		1730793600 306
Description: 11/5
Author: aehodges
Session Name: hg38//custom tracks
Genome Assembly: hg38
Creation Date: 2024-11-05
Views: 250 		1730793600 250
Description: RNA-seq custom tracks activity - RHO
Author: madisonflorenz
Session Name: RNA-seq custom tracks activity - RHO
Genome Assembly: hg38
Creation Date: 2024-11-05
Views: 355 		1730793600 355
Description: Rhodopsin
Author: ALLDEREP
Session Name: hg38RHOMacula
Genome Assembly: hg38
Creation Date: 2024-11-05
Views: 302 		1730793600 302
Description: This custom track displays genomic intervals from the provided test.bed file, showing regions of interest for our class assignment. The data spans chromosomes 1 and 7 and highlights segments related to gene regulation and expression.
Author: Shamitha
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2024-11-05
Views: 351 		1730793600 351
Description: This session contains custom tracks visualizing specific features on chromosome 22 between positions 20,100,000 and 20,140,000. It includes: Spacer Track: Description: Blue ticks placed every 10,000 bases. Color: Blue (RGB: 0, 0, 255) Key Positions: chr22:20100000-20100001 chr22:20110000-20110001 chr22:20120000-20120001 Even Track: Description: Red ticks placed every 100 bases, with skips of 100 bases between ticks. Color: Red (RGB: 255, 0, 0) Key Positions: chr22:20100000-20100100 (first) chr22:20100200-20100300 (second) chr22:20100400-20100500 (third)
Author: taliaroth19
Session Name: Module 8 Assignment
Genome Assembly: hg38
Creation Date: 2024-11-04
Views: 303 		1730707200 303
Description: Encode 4 atacseq, chipseq, small rnaseq, polyA positive rna seq
Author: agurha
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2026-05-13
Views: 76 		1778659200 76
Description: customs tracks but better
Author: ALLDEREP
Session Name: hg38CustomTracksPractice - EA
Genome Assembly: hg38
Creation Date: 2024-10-31
Views: 312 		1730361600 312
Description: custom tracks
Author: ALLDEREP
Session Name: CustomTracks_Test
Genome Assembly: hg19
Creation Date: 2024-10-31
Views: 320 		1730361600 320
Description: CLIP2 is a gene that is related to linker protein function. Various RefSeq comparisons are aligned with expression levels from a variety of tissues.
Author: gwilds
Session Name: clip2
Genome Assembly: hg19
Creation Date: 2024-10-31
Views: 318 		1730361600 318
Description: MAPT mutations
Author: diazacex
Session Name: MAPT GB custom tracks
Genome Assembly: hg38
Creation Date: 2024-10-31
Views: 334 		1730361600 334
Description: MAPT mutations looged by Clayton Fannin
Author: ClaytonFannin
Session Name: hg38 MAPT mutations Group 5 (CAF)
Genome Assembly: hg38
Creation Date: 2024-10-31
Views: 334 		1730361600 334
Description: 10/31 Intro to UCSC Custom Data tracks
Author: madisonflorenz
Session Name: 10/31 Intro to UCSC Custom Data tracks
Genome Assembly: hg38
Creation Date: 2024-10-31
Views: 297 		1730361600 297
Description: 10/31/24
Author: aehodges
Session Name: hg38//MAPT gene
Genome Assembly: hg38
Creation Date: 2024-10-31
Views: 326 		1730361600 326
Description: UCSC GB custom tracks intro part 1A
Author: madisonflorenz
Session Name: UCSC GB custom tracks intro part 1A
Genome Assembly: hg19
Creation Date: 2024-10-31
Views: 322 		1730361600 322
Description: practicing custom tracks
Author: diazacex
Session Name: RHO Practice
Genome Assembly: hg19
Creation Date: 2024-10-31
Views: 303 		1730361600 303
Description: 10/31/24
Author: aehodges
Session Name: hg19//custom track
Genome Assembly: hg19
Creation Date: 2024-10-31
Views: 291 		1730361600 291
Description: ELK3 promoter region
Author: gauravagarwal
Session Name: ELK3_promoter
Genome Assembly: hg38
Creation Date: 2024-10-29
Views: 758 		1730188800 758
Description: Looking at the mutations in distal and tumor tissue of liver (hepatocellular carcinoma) in Patient #8. The mutations found exclusively in tumor tissue biopsy are highlighted in blue windows.
Author: dlk_browse
Session Name: Patient8_ND6
Genome Assembly: hg38
Creation Date: 2024-10-14
Views: 1201 		1728892800 1201
Description: Ridley Ch 4 HTT Fig 1
Author: madisonflorenz
Session Name: Ridley Ch 4 HTT Fig 1
Genome Assembly: hg38
Creation Date: 2024-10-14
Views: 471 		1728892800 471
Description: Ridley Ch 4 HTT Fig 2
Author: madisonflorenz
Session Name: Ridley Ch 4 HTT Fig 2
Genome Assembly: hg38
Creation Date: 2024-10-14
Views: 471 		1728892800 471
Description: 10/13/24
Author: aehodges
Session Name: hg38/HTT Gene
Genome Assembly: hg38
Creation Date: 2024-10-13
Views: 318 		1728806400 318
Description: THP-1 monocyte PMA timecourse
Author: Firefoot97
Session Name: T2T_monocyte_PMA_timecourse
Genome Assembly: hub_3671779_hs1
Creation Date: 2024-10-10
Views: 345 		1728547200 345
Description: Tracks H3K9me3 during E5 gametocytogenesis
Author: sandracula
Session Name: Sci-Rep_H3K9me3_gametocytes
Genome Assembly: hub_4042823_pfa2
Creation Date: 2024-10-04
Views: 510 		1728028800 510
Description: For Art & Katja
Author: mc.sierant
Session Name: RNU4-2_cons
Genome Assembly: hg38
Creation Date: 2024-09-30
Views: 691 		1727683200 691
Description: Genes e Microssatélites do Salminus brasiliensis set/2024 - LARGE_UFSJ
Author: jguimasr
Session Name: LARGE_UFSJ-GCA_030463535.1
Genome Assembly: hub_4414904_GCA_030463535.1
Creation Date: 2024-08-05
Views: 416 		1722844800 416
Description: Exon 10
Author: sofiaterenziani
Session Name: Exon 10 - HDG gene
Genome Assembly: hg38
Creation Date: 2024-09-26
Views: 301 		1727337600 301
Description: HDG_hg38
Author: l.g.altizer
Session Name: HDG_hg38
Genome Assembly: hg38
Creation Date: 2024-09-24
Views: 558 		1727164800 558
Description: HDG gene
Author: sofiaterenziani
Session Name: hg38 - HDG gene
Genome Assembly: hg38
Creation Date: 2024-09-24
Views: 496 		1727164800 496
Description: 9/24/24
Author: aehodges
Session Name: hg38//HGD session 2
Genome Assembly: hg38
Creation Date: 2024-09-24
Views: 489 		1727164800 489
Description: HGD gene - Figure 2
Author: madisonflorenz
Session Name: HGD gene - Figure 2
Genome Assembly: hg38
Creation Date: 2024-09-24
Views: 307 		1727164800 307
Description: Human genome HGD gene
Author: rchelsea
Session Name: hg38 HGD #1
Genome Assembly: hg38
Creation Date: 2024-09-24
Views: 269 		1727164800 269
Description: hg38HGDExon10
Author: ALLDEREP
Session Name: hg38HGDExon10
Genome Assembly: hg38
Creation Date: 2024-09-24
Views: 330 		1727164800 330
Description: HGD gene - Figure 1
Author: madisonflorenz
Session Name: HGD gene - Figure 1
Genome Assembly: hg38
Creation Date: 2024-09-24
Views: 349 		1727164800 349
Description: hg38 HGD
Author: ALLDEREP
Session Name: hg38 HGD
Genome Assembly: hg38
Creation Date: 2024-09-24
Views: 310 		1727164800 310
Description: edwcdewd
Author: maddiebendele
Session Name: HGD gene
Genome Assembly: hg38
Creation Date: 2024-09-23
Views: 318 		1727078400 318
Description: 9/20/24
Author: aehodges
Session Name: hg38//HGD gene
Genome Assembly: hg38
Creation Date: 2024-09-20
Views: 292 		1726819200 292
Description: Human chr2 compared to other mammals
Author: sofiaterenziani
Session Name: hg38 - chr2 + other organisms
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 518 		1726560000 518
Description: Human and other primates
Author: rchelsea
Session Name: hg38 chr2 #2
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 489 		1726560000 489
Description: 9/17/24
Author: aehodges
Session Name: hg38//session 2
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 515 		1726560000 515
Description: Region of Human Chr2 in Ridley Chapter and Other Primates
Author: madisonflorenz
Session Name: Region of Human Chr2 in Ridley Chapter and Other Primates
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 325 		1726560000 325
Description: wow
Author: maddiebendele
Session Name: Fusion_Event_Bendele
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 329 		1726560000 329
Description: Synteny and Conservation among Primates and the human
Author: ALLDEREP
Session Name: Synteny and Conservation among Primates
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 314 		1726560000 314
Description: Human and chimp chromosome #2
Author: rchelsea
Session Name: hg38 chr2
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 316 		1726560000 316
Description: hg38 chromosome 2 comparison
Author: ClaytonFannin
Session Name: hg38 chromosome 2 comparison
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 356 		1726560000 356
Description: region of human chromosome 2 discussed in the Ridley chapter
Author: madisonflorenz
Session Name: Region of Human Chr2 in Ridley Chapter
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 312 		1726560000 312
Description: Humans vs different Ape comparison of chr 3
Author: diazacex
Session Name: Comparison of Chr 3
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 312 		1726560000 312
Description: hg38 chromosome 2 full comparison
Author: ClaytonFannin
Session Name: hg38 chromosome 2 full comparison
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 340 		1726560000 340
Description: Human chromosome 2 in comparison to chimp chromosomes to show fusion.
Author: l.g.altizer
Session Name: Chimp_fusion
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 338 		1726560000 338
Description: Human fusion
Author: maddiebendele
Session Name: FusionEventBendele
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 338 		1726560000 338
Description: for prez
Author: maddiebendele
Session Name: p.aergiona presentation
Genome Assembly: hub_3560215_GCF_000006765.1
Creation Date: 2024-09-17
Views: 354 		1726560000 354
Description: Ridley Ch2 Species Pt. 1
Author: madisonflorenz
Session Name: Ridley Ch2 Species Pt. 1
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 377 		1726560000 377
Description: Comparison on Chr2 with chimps
Author: sofiaterenziani
Session Name: hg38 - chr2
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 307 		1726560000 307
Description: human chr2 synteny to chimps
Author: marte2je
Session Name: hg38 chimp - chr2
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 311 		1726560000 311
Description: comparison of the KPNA6 gene from humans to opossums
Author: ALLDEREP
Session Name: M.Domestica Comparison
Genome Assembly: hg19
Creation Date: 2024-09-15
Views: 318 		1726387200 318
Description: H3K27ac ChIP-seq and RNA-seq of lung neuroendocrine tumors from GSE247574.
Author: yotamd
Session Name: lung_NET
Genome Assembly: hg38
Creation Date: 2024-09-10
Views: 721 		1725955200 721
Description: CRX gene isoforms
Author: madisonflorenz
Session Name: CRX gene isoforms
Genome Assembly: hg38
Creation Date: 2024-09-10
Views: 548 		1725955200 548
Description: CRX gene
Author: ClaytonFannin
Session Name: CRX gene BIO481 CAF
Genome Assembly: hg38
Creation Date: 2024-09-10
Views: 571 		1725955200 571
Description: 9/10
Author: aehodges
Session Name: CRX Gene
Genome Assembly: hg38
Creation Date: 2024-09-10
Views: 331 		1725955200 331
Description: RHO
Author: ALLDEREP
Session Name: hg19 RHO
Genome Assembly: hg19
Creation Date: 2024-09-02
Views: 359 		1725264000 359
Description: The custom tracts represent Hop1 ChIP-Seq data in wild type, ATPase deficient mutant and null mutant. Bam files contains uniquely mapped reads to S. cerevisiae genome. The sample information is given below: 1. m_sorted_mapped_cer_HP1_4h_Ch_1.bam- Hop1 WT replicate 1, 2. m_sorted_mapped_cer_HP1_4h_Ch_2.bam- Hop1 WT replicate 2, 3. m_sorted_mapped_cer_HP1_4h_In_1.bam- Hop1 WT input, 4. m_sorted_mapped_cer_SK_Hp1m_4h_Ch1.bam- Hop1 ATPase mutant replicate 1, 5. m_sorted_mapped_cer_SK_Hp1m_4h_Ch2.bam- Hop1 ATPase mutant replicate 2, 6. m_sorted_mapped_cer_SK_Hp1m_4h_In2.bam- Hop1 ATPase mutant input, 7. m_sorted_mapped_cer_hp1_4h_Ch_1.bam- Hop1 null mutant repliacte 1, 8. m_sorted_mapped_cer_hp1_4h_Ch_2.bam- Hop1 null mutant replicate 2, 9. m_sorted_mapped_cer_hp1_4h_In_1.bam- Hop1 null mutant input
Author: Sameerjoshi1997
Session Name: Hop1 ChIP-Seq data
Genome Assembly: sacCer3
Creation Date: 2024-09-04
Views: 682 		1725436800 682
Description: Quiz 2
Author: sofiaterenziani
Session Name: hg19 RHO 2
Genome Assembly: hg19
Creation Date: 2024-09-03
Views: 552 		1725350400 552
Description: Abigail Hodges
Author: aehodges
Session Name: hg19 RHO redo
Genome Assembly: hg19
Creation Date: 2024-09-03
Views: 569 		1725350400 569
Description: Quiz 1
Author: sofiaterenziani
Session Name: hg19 RHO
Genome Assembly: hg19
Creation Date: 2024-09-03
Views: 347 		1725350400 347
Description: RHO
Author: diazacex
Session Name: RHO_hg19
Genome Assembly: hg19
Creation Date: 2024-09-03
Views: 342 		1725350400 342
Description: hg19 RHO
Author: madelinebarlas
Session Name: hg19 RHO
Genome Assembly: hg19
Creation Date: 2024-09-03
Views: 351 		1725350400 351
Description: RHO gene and OMIM Alleles
Author: l.g.altizer
Session Name: hg19 RHO
Genome Assembly: hg19
Creation Date: 2024-09-03
Views: 332 		1725350400 332
Description: RHO Gene & OMIM & Multi
Author: l.g.altizer
Session Name: hg19_RHO_2
Genome Assembly: hg38
Creation Date: 2024-09-03
Views: 337 		1725350400 337
Description: hg19 RHO - quiz #2
Author: madisonflorenz
Session Name: hg19 RHO - quiz #2
Genome Assembly: hg19
Creation Date: 2024-09-02
Views: 282 		1725264000 282
Description: hg19 RHO - Quiz 1
Author: gplaughon912
Session Name: hg19 RHO
Genome Assembly: hg19
Creation Date: 2024-09-02
Views: 310 		1725264000 310
Description: hg19 RHO - Quiz 2
Author: gplaughon912
Session Name: hg19 RHO - Session 2
Genome Assembly: hg19
Creation Date: 2024-09-02
Views: 361 		1725264000 361
Description: RHO NEW
Author: ALLDEREP
Session Name: hg19RHO NEW
Genome Assembly: hg19
Creation Date: 2024-09-02
Views: 306 		1725264000 306
Description: same as the previous rho but with highlight
Author: maddiebendele
Session Name: hg19 RHO2
Genome Assembly: hg19
Creation Date: 2024-09-02
Views: 304 		1725264000 304
Description: Quiz 2
Author: aehodges
Session Name: hg19 RHO session 2
Genome Assembly: hg19
Creation Date: 2024-09-01
Views: 315 		1725177600 315
Description: hg19 RHO
Author: ClaytonFannin
Session Name: hg19 RHO
Genome Assembly: hg19
Creation Date: 2024-09-01
Views: 330 		1725177600 330
Description: It is tracked by samples and treatment groups. Some differentially accessible peaks highlighted
Author: Pengxin Yang
Session Name: pig_BCG_ATAC_filtered_by_sample_and_merged_highlight
Genome Assembly: susScr11
Creation Date: 2025-03-03
Views: 211 		1740988800 211
Description: Fall24 MouseBIO481 group5 (CAF)
Author: ClaytonFannin
Session Name: Fall24 MouseBIO481 group5 (CAF)
Genome Assembly: mm9
Creation Date: 2024-08-29
Views: 340 		1724918400 340
Description: Fall24 Worm BIO481 group#3
Author: madisonflorenz
Session Name: Fall24 Worm BIO481 group#3
Genome Assembly: ce11
Creation Date: 2024-08-29
Views: 275 		1724918400 275
Description: First experience using UCSC Genome Browser looking at the Rhodopsin gene of a mouse
Author: ALLDEREP
Session Name: Fall24 MouseBIO481 group5
Genome Assembly: mm9
Creation Date: 2024-08-29
Views: 341 		1724918400 341
Description: C.elegans ICD-1
Author: marte2je
Session Name: Fall24 Worm Bio481 group 3 #2
Genome Assembly: ce11
Creation Date: 2024-08-29
Views: 276 		1724918400 276
Description: Fall24 MouseBIO481 group6
Author: madelinebarlas
Session Name: Fall24 MouseBIO481 group6
Genome Assembly: mm9
Creation Date: 2024-08-29
Views: 345 		1724918400 345
Description: CGEMS Mouse AEH Test
Author: aehodges
Session Name: Fall24 MouseBIO481 group6
Genome Assembly: mm9
Creation Date: 2024-08-29
Views: 354 		1724918400 354
Description: Fall24 Worm BIO481 group#3 C. elegans
Author: sofiaterenziani
Session Name: Fall24 Worm BIO481 group#3
Genome Assembly: ce11
Creation Date: 2024-08-29
Views: 305 		1724918400 305
Description: Fall24 Worm BIO481 group 3
Author: rchelsea
Session Name: Fall24 Worm BIO481 group 3
Genome Assembly: ce11
Creation Date: 2024-08-29
Views: 370 		1724918400 370
Description: MEK
Author: diazacex
Session Name: Fall24 Yeast BIO481 group#2
Genome Assembly: sacCer3
Creation Date: 2024-08-29
Views: 283 		1724918400 283
Description: In class assignment 8/29
Author: Mitcheij
Session Name: Fall24 Worm BIO481 group 4
Genome Assembly: ce11
Creation Date: 2024-08-29
Views: 345 		1724918400 345
Description: C. elegans ICD-1
Author: marte2je
Session Name: Fall24 Worm Bio481 group 3
Genome Assembly: ce11
Creation Date: 2024-08-29
Views: 338 		1724918400 338
Description: BIO481 UCSC Genome Browser Assignment - Group 5 Mouse
Author: gplaughon912
Session Name: Fall24 MouseBIO481 Group5
Genome Assembly: mm9
Creation Date: 2024-08-29
Views: 342 		1724918400 342
Description: CRX
Author: ALLDEREP
Session Name: hg38 CRX
Genome Assembly: hg38
Creation Date: 2024-09-12
Views: 323 		1726128000 323
Description: For Bioinformatics class assignment purpose, to be viewed by the instructors.
Author: hemib
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2024-10-08
Views: 336 		1728374400 336
Description: CUT&RUN dataset for Six3 (with antibodies Six3_abs and Six3_ori), Six6, and IgG control for mouse embryonic retinas at E13.5.
Author: Wei_einstein
Session Name: PlosOne
Genome Assembly: mm10
Creation Date: 2024-08-08
Views: 1256 		1723104000 1256
Description: hg19 RHO altered for quiz 2
Author: ClaytonFannin
Session Name: hg19 RHO altered
Genome Assembly: hg19
Creation Date: 2024-09-02
Views: 312 		1725264000 312
Description: GWAS endometriosis associations around RERG
Author: Pkgg77
Session Name: RERG - ras ER reg high in uterus CHR12
Genome Assembly: hg19
Creation Date: 2024-07-22
Views: 1767 		1721635200 1767
Description: Genocvesa CNV visualisation
Author: prague2017
Session Name: GENOVESA_CNV_DEFAULTS
Genome Assembly: hg38
Creation Date: 2026-03-02
Views: 44 		1772438400 44
Description: MPAC predictions on all of Gnomad. See html files associated with tracks and https://www.biorxiv.org/content/10.1101/2025.04.16.648420v1.full for more information
Author: saarantras
Session Name: MPAC_gnomad
Genome Assembly: hg38
Creation Date: 2025-06-09
Views: 126 		1749456000 126
Description: These datasets are part of the manuscript title: Interpreting regulatory mechanisms of Hippo signaling through a deep learning sequence model. https://doi.org/10.1101/2024.02.22.580842 Example browser position : chr15:102015496-102017061
Author: KhyatiD
Session Name: Dalal_hippo_pathway_TFs_mm10
Genome Assembly: mm10
Creation Date: 2025-02-19
Views: 258 		1739952000 258
Description: This session shows how UShER can place H5N1 sequences on the tree of viral samples. Here are the steps to replicate a similar session. First find an example viral sequence such as SRR28752449_HA_cns.fa in this repository: https://github.com/andersen-lab/avian-influenza/tree/master/fasta With the fasta sequence copied follow these steps. 1. Navigate to UShER, quick link: https://usher.bio 2. Paste in a sequence: >Consensus_SRR28752449_HA_cns_threshold_0.5_quality_20 ATGGAGAACATAG... 3. Click "Upload" 4. Click "View in Genome Browser" 5. Note the placement near the branch of H5N1 near other cattle lineages (click session image on the left to see, find the light blue horizontal line highlighting Consensus_SRR28752449).
Author: brianlee
Session Name: H5N1
Genome Assembly: hub_4086371_GCF_000864105.1
Creation Date: 2024-07-01
Views: 1774 		1719820800 1774
Description: hg38 CNGB1 alt polyA isoforms
Author: renkejhsph
Session Name: hg38 CNGB1 alt polyA isoforms
Genome Assembly: hg38
Creation Date: 2024-06-19
Views: 1291 		1718784000 1291
Description: Archaic introgression identified with the use of hmmix by Skov et al., (https://github.com/LauritsSkov/Introgression-detection). Genotype data from 1000 genomes projects.
Author: daxa213
Session Name: hg19_SkovHMM_1
Genome Assembly: hg19
Creation Date: 2024-10-29
Views: 322 		1730188800 322
Description: Trackplots Including WT, Chx10-Cre;Ptbp1lox/+(Het1-3) and Chx10-Cre;Ptbp1lox/lox(KO), together with trackplots from ASCOT (Ling et al 2020)
Author: roggercarmen
Session Name: Ptbp1KO_Retina
Genome Assembly: mm10
Creation Date: 2025-07-01
Views: 185 		1751356800 185
Description: HumanDevelopingRetinaAtlas
Author: zhenzuo2
Session Name: HumanDevelopingRetinaAtlas
Genome Assembly: hg38
Creation Date: 2024-06-06
Views: 1330 		1717660800 1330
Description: "A two-step regulatory mechanism dynamically controls histone H3 acetylation by SAGA complex at growth-related promoters" paper genome wide data (Zencir et al., 2024)
Author: sevil
Session Name: GSE268170_BIGWIG FILES
Genome Assembly: sacCer3
Creation Date: 2024-06-05
Views: 768 		1717574400 768
Description: All QTLs from datasets in our S. cerevisiae QTL datasets reanalysis. QTL Track Name Format: - GENE::dataset_name$$LOD, where LOD is rounded to the nearest integer Relevant Fields: - Color: blue for mRNA QTLs, brown for protein QTLs, black for xQTLs - Color Intensity: darker with increasing QTL LOD - Strand: direction of QTL as considered in the paper - Arrows: right for positive QTL effect
Author: matthewf
Session Name: Reanalysis of QTL Datasets
Genome Assembly: sacCer3
Creation Date: 2024-08-05
Views: 366 		1722844800 366
Description: long retinal isoform of shisa5
Author: JonathanM70
Session Name: hg38 shisa5 long isoform
Genome Assembly: hg38
Creation Date: 2024-06-03
Views: 626 		1717401600 626
Description: https://doi.org/10.1016/j.xhgg.2026.100630
Author: Wen-Cheng
Session Name: Liver_rs6882076
Genome Assembly: hg19
Creation Date: 2024-04-02
Views: 136 		1712044800 136
Description: Chip-seq
Author: ucscfzl
Session Name: SIRT3KO
Genome Assembly: hg38
Creation Date: 2024-08-21
Views: 374 		1724227200 374
Description: nair
Author: xiaopei
Session Name: hg38_xiaopei_May20
Genome Assembly: hg38
Creation Date: 2024-05-20
Views: 851 		1716192000 851
Description: test
Author: xiaopei
Session Name: hg38_test2
Genome Assembly: hg38
Creation Date: 2024-05-20
Views: 768 		1716192000 768
Description: test 1
Author: xiaopei
Session Name: hg38_test1
Genome Assembly: hg38
Creation Date: 2024-05-20
Views: 636 		1716192000 636
Description: ATAC-seq YZ
Author: Yichao Zhou
Session Name: NewATAC-seq analysis
Genome Assembly: mm10
Creation Date: 2024-05-20
Views: 336 		1716192000 336
Description: hg18_rnaseq
Author: hyfydky
Session Name: hg18_rnaseq
Genome Assembly: hg18
Creation Date: 2024-05-18
Views: 427 		1716019200 427
Description: hg38_GSE176016
Author: hyfydky
Session Name: hg38_GSE176016
Genome Assembly: hg38
Creation Date: 2024-05-10
Views: 1020 		1715328000 1020
Description: c.4619T>G P.Leu1540Arg Revel score
Author: sk202
Session Name: VWF_1540
Genome Assembly: hg19
Creation Date: 2024-05-16
Views: 449 		1715846400 449
Description: test
Author: yunna
Session Name: test
Genome Assembly: hg38
Creation Date: 2024-05-02
Views: 655 		1714636800 655
Description: isPCR hits in two adjacent genes. Shows amplicons expected if using mRNA as template.
Author: netherlands2024
Session Name: hg19_isPCR
Genome Assembly: hg19
Creation Date: 2024-04-29
Views: 1519 		1714377600 1519
Description: Microsatellites Density Landscape (Main track) Including sub-tracks: Landscape of STR Density, HMDP, MMDP, LMDP Description: "The microsatellite, also called short tandem repeats (STRs), density landscapes illustrated the relative density of local microsatellites per kilobase of sequence along the complete reference Human Genome T2T-CHM13, indicating that microsatellites tend to aggregate in a characteristic manner, resulting in numerous microsatellite density peaks throughout the genome. These microsatellite density peaks can be categorized into three distinct types: High Microsatellite Density Peak (HMDP), Middle Microsatellite Density Peak (MMDP), and Low Microsatellite Density Peak (LMDP). Therefore, the main track contains four sub-tracks which are Landscape of STR Density, HMDP, MMDP, LMDP. Methods: Each chromosome sequence of T2T-CHM13 was divided into a large number of units (bins) by the differential method with a resolution of 1kb. The local microsatellite relative density in every 1kb resolution unit was referred as position-related Differential-unit1kb (D1) Relative Density (pD1RD) and calculated by formula: pD1RDi = mi/1kb × 1000. Track statistics summary: Genome Assembled Size (bp): 3,117,275,501 Total peak count: 244,729 HMDP count: 8,823 MMDP count: 36,257 LMDP count: 199,649 Microsatellites Density Landscape References: Xia Y, Li D, Chen T, Pan S, Huang H, Zhang W, Liang Y, Fu Y, Peng Z, Zhang H et al. Microsatellite density landscapes illustrate short tandem repeats aggregation in the complete reference human genome. BMC Genomics. 2024; 25(1):960. PMID: 39402450; DOI: 10.1186/s12864-024-10843-9 Li D, Pan S, Zhang H, Fu Y, Peng Z, Zhang L, et al. A comprehensive microsatellite landscape of human Y-DNA at kilobase resolution. BMC genomics. 2021; 22(1):76. PMID: 33482734; PMCID: PMC7821415
Author: zhongyangtan
Session Name: CHM13v2.0
Genome Assembly: hub_3671779_hs1
Creation Date: 2023-09-10
Views: 861 		1694332800 861
Description: CRX binding sites for HTT gene in mouse genome
Author: eraterman
Session Name: mm9 HTT
Genome Assembly: mm9
Creation Date: 2024-04-10
Views: 1827 		1712736000 1827
Description: CRX binding sites for THRB gene in mouse genome
Author: eraterman
Session Name: mm9 THRB
Genome Assembly: mm9
Creation Date: 2024-04-10
Views: 1446 		1712736000 1446
Description: CRX binding sites for PDE6A gene in mouse genome
Author: eraterman
Session Name: mm9 PDE6A
Genome Assembly: mm9
Creation Date: 2024-04-10
Views: 729 		1712736000 729
Description: CRX binding sites for RCVRN gene in mouse genome
Author: eraterman
Session Name: mm9 RCVRN
Genome Assembly: mm9
Creation Date: 2024-04-10
Views: 468 		1712736000 468
Description: CRX binding sites for RHO gene in mouse genome
Author: eraterman
Session Name: mm9 RHO
Genome Assembly: mm9
Creation Date: 2024-04-10
Views: 465 		1712736000 465
Description: class assignment 4-10-24
Author: ShMaBe
Session Name: CRX ChIP Seq wt Nrl
Genome Assembly: mm9
Creation Date: 2024-04-10
Views: 431 		1712736000 431
Description: lab 4-3
Author: Ruffi2ec
Session Name: Lab due 4-3
Genome Assembly: hg38
Creation Date: 2024-04-04
Views: 444 		1712217600 444
Description: This session contains a custom track showing near coding regions in PanelApp green genes, as described in the article "Systematic identification of disease-causing promoter and untranslated region variants in 8,040 undiagnosed individuals with rare disease" Martin-Geary et al 2024
Author: ageary
Session Name: CRDG 'Near coding regions' Martin-Geary et al '24
Genome Assembly: hg38
Creation Date: 2024-04-05
Views: 507 		1712304000 507
Description: yes
Author: aryanzandi123
Session Name: REST and Co-repressor Window
Genome Assembly: hg38
Creation Date: 2024-12-11
Views: 384 		1733904000 384
Description: a demo
Author: xiyuan09
Session Name: xyuan2024-hg19
Genome Assembly: hg19
Creation Date: 2024-03-30
Views: 669 		1711785600 669
Description: U2AF2 iCLIP (Sutandy et al 2018) and eCLIP (ENCODE) processed with racoon_clip
Author: melinak
Session Name: U2AF2_iCLIP_and_eCLIP
Genome Assembly: hg38
Creation Date: 2024-04-12
Views: 508 		1712908800 508
Description: Ribosome Footprinting profile of miR181a/b-1 knockout vs wildtype in mouse thymocytes with three samples each. Data from Verheyden and Klostermann et al. 2024 (https://www.biorxiv.org/content/10.1101/2023.09.08.556730v1)
Author: melinak
Session Name: miR181_RibosomeFootprint_Verheyden&Klostermann_2024
Genome Assembly: mm10
Creation Date: 2024-03-26
Views: 852 		1711440000 852
Description: hg19 RHO #2 Quiz #@
Author: rchelsea
Session Name: hg19 RHO #2
Genome Assembly: hg19
Creation Date: 2024-09-02
Views: 264 		1725264000 264
Description: hg19 RHO Quiz #1
Author: rchelsea
Session Name: hg19 RHO
Genome Assembly: hg19
Creation Date: 2024-09-02
Views: 341 		1725264000 341
Description: hg19 RHO
Author: madisonflorenz
Session Name: hg19 RHO
Genome Assembly: hg19
Creation Date: 2024-09-02
Views: 337 		1725264000 337
Description: miR181-eCLIP data from Verheyden and Klostermann et.al. 2024. Shown are the chimeric and non-chimeric crosslinks for four conditions: Ago2 IP Ago2 IP with enrichment for miR181 Ago2 IP with miR181a/b-1 knockout Ago2 IP with miR181a/b-1 knockout and a following enrichment for miR181 In addition binding sites are shown for Ago2 IP Ago2 IP with enrichment for miR181 Ago2 IP with miR181a/b-1 knockout And the differential binding sites of Ago2 IP with miR181a/b-1 knockout vs Ago2 IP
Author: melinak
Session Name: miR181-eCLIP_Verheyden&Klostermann_2024
Genome Assembly: mm10
Creation Date: 2024-03-25
Views: 650 		1711353600 650
Description: This browser track accompanies the Alternative Proteome Detection Project out of the Sheynkman Lab at the University of Virginia.
Author: emilyfwatts
Session Name: Alternative-Proteome-Detection
Genome Assembly: hg38
Creation Date: 2024-03-15
Views: 633 		1710489600 633
Description: Rearrangements of the 17q24.3 region associated with abnormal phenotypes.
Author: 429035671
Session Name: Pei_et_al_2024_fig6
Genome Assembly: hg19
Creation Date: 2024-03-11
Views: 992 		1710144000 992
Description: Test session for Module 7 of BINF 6310.
Author: oconnor.ea
Session Name: oconnor-binf6310
Genome Assembly: hg38
Creation Date: 2024-03-01
Views: 1137 		1709280000 1137
Description: Blue ticks every 10000 bases. Red ticks every 100 bases, skip 100
Author: lizkiefer
Session Name: hg38_chr22_KieferLiz
Genome Assembly: hg38
Creation Date: 2024-02-27
Views: 1657 		1709020800 1657
Description: ATAC-seq of MaSC(mammary stem cell)
Author: woaichixiangcai
Session Name: MaSC_ATAC
Genome Assembly: mm10
Creation Date: 2024-02-18
Views: 936 		1708243200 936
Screenshot not available
Click Here to view
 Description: Track Decorators help page: https://genome.ucsc.edu/goldenPath/help/decorator.html
Author: BGMP2024
Session Name: Track_Decorators
Genome Assembly: hg38
Creation Date: 2024-01-28
Views: 913 		1706428800 913
Screenshot not available
Click Here to view
 Description: Highlighted exons 5-8 of ENST00000269305.9
Author: BGMP2024
Session Name: hg38_BGMP2024_Ex
Genome Assembly: hg38
Creation Date: 2024-01-28
Views: 1177 		1706428800 1177
Description: practice
Author: jordancibellis
Session Name: hg19_480L
Genome Assembly: hg19
Creation Date: 2024-01-24
Views: 849 		1706083200 849
Description: BIO480L Spring 24
Author: penguinttoes
Session Name: hg19_newsome
Genome Assembly: hg19
Creation Date: 2024-01-24
Views: 585 		1706083200 585
Description: te
Author: aryanzandi123
Session Name: Polycomb and Chromatin-Binding Proteins Window
Genome Assembly: hg38
Creation Date: 2024-12-11
Views: 321 		1733904000 321
Description: This session features a track hub with MaveDB experiment datasets mapped to the GRCh38 reference genome
Author: mcline
Session Name: MaveDB
Genome Assembly: hg38
Creation Date: 2024-04-03
Views: 769 		1712131200 769
Description: PE2 editing efficiency in synHEK3 reporters in K562 cells
Author: lxyttpp912
Session Name: hg38_synHEK3_hub
Genome Assembly: hg38
Creation Date: 2023-12-26
Views: 1197 		1703577600 1197
Description: Differentially methylated CGIs under DiPRO/ZNF555 knockdown in human rhabdomyosarcoma and myoblast cells (shDiPRO1 vs. non-targeting shCTL)
Author: dr_finder
Session Name: metCGI_ZNF55/DiPRO1_2023
Genome Assembly: hg38
Creation Date: 2023-12-20
Views: 454 		1703059200 454
Description: Coverage tracks from SF3B1-humanized yeast treated with splicing inhibitors Plad-B and Thail-A from Hunter et al. Published in RNA
Author: mannyares
Session Name: Hunter_etal
Genome Assembly: sacCer3
Creation Date: 2023-12-13
Views: 1102 		1702454400 1102
Description: may
Author: xiaopei
Session Name: hg38_xiaopei_May21
Genome Assembly: hg38
Creation Date: 2024-05-21
Views: 406 		1716278400 406
Description: bigWig files for promoter NDR resetting after replication (Zencir et al.,2024)
Author: julien_soudet
Session Name: EdU_replication
Genome Assembly: sacCer3
Creation Date: 2024-05-31
Views: 438 		1717142400 438
Description: CTCF loops, Oxford nanopore phased methylation and RNAseq in LUHMES cell line for the 15q11-q13 region. View of AS imprinted region as shown in Figure 7A of Gutierrez Fugon et al, Human Molecular Genetics, 2024.
Author: ojg333
Session Name: AS_Locus_Fig7A_Fugon_2024
Genome Assembly: hg19
Creation Date: 2023-12-06
Views: 430 		1701849600 430
Description: A snapshot from the genome browser displaying the enrichment of H3K27ac in the replicates of the two groups, with and without sodium lactate.Yanhua Zhao, Meiting Zhang, Xingwei Huang, Jiqiang Liu, Yuchen Sun, Fan Zhang, Na Zhang and Lei Lei Lactate modulates zygotic genome activation though H3K18 lactylation rather than H3K27 acetylation.
Author: ZhangMeiTing
Session Name: H3K27ac
Genome Assembly: mm10
Creation Date: 2023-12-03
Views: 832 		1701590400 832
Description: The UCSC Browser show the enrichment of the H3K27ac signal of Eif2b5 in both +L and -L groups.Yanhua Zhao, Meiting Zhang, Xingwei Huang, Jiqiang Liu, Yuchen Sun, Fan Zhang, Na Zhang and Lei Lei Lactate modulates zygotic genome activation though H3K18 lactylation rather than H3K27 acetylation.
Author: ZhangMeiTing
Session Name: Eif2b5_H3K27ac
Genome Assembly: mm10
Creation Date: 2023-12-03
Views: 650 		1701590400 650
Description: The UCSC Browser show the enrichment of the H3K27ac signal of Ccnt1 in both +L and -L groups.Yanhua Zhao, Meiting Zhang, Xingwei Huang, Jiqiang Liu, Yuchen Sun, Fan Zhang, Na Zhang and Lei Lei Lactate modulates zygotic genome activation though H3K18 lactylation rather than H3K27 acetylation.
Author: ZhangMeiTing
Session Name: Ccnt1_H3K27ac
Genome Assembly: mm10
Creation Date: 2023-12-03
Views: 620 		1701590400 620
Description: The UCSC Browser show the enrichment of the H3K27ac signal of Dppa2 in both +L and -L groups.Yanhua Zhao, Meiting Zhang, Xingwei Huang, Jiqiang Liu, Yuchen Sun, Fan Zhang, Na Zhang and Lei Lei Lactate modulates zygotic genome activation though H3K18 lactylation rather than H3K27 acetylation.
Author: ZhangMeiTing
Session Name: Dppa2_H3K27ac
Genome Assembly: mm10
Creation Date: 2023-12-03
Views: 550 		1701590400 550
Description: The UCSC Browser show the enrichment of the H3K18la signal of Ccnt1 in both +L and -L groups.Yanhua Zhao, Meiting Zhang, Xingwei Huang, Jiqiang Liu, Yuchen Sun, Fan Zhang, Na Zhang and Lei Lei Lactate modulates zygotic genome activation though H3K18 lactylation rather than H3K27 acetylation.
Author: ZhangMeiTing
Session Name: Ccnt1_H3K18la
Genome Assembly: mm10
Creation Date: 2023-12-03
Views: 555 		1701590400 555
Description: The UCSC Browser show the enrichment of the H3K18la signal of Eif2b5 in both +L and -L groups.Yanhua Zhao, Meiting Zhang, Xingwei Huang, Jiqiang Liu, Yuchen Sun, Fan Zhang, Na Zhang and Lei Lei Lactate modulates zygotic genome activation though H3K18 lactylation rather than H3K27 acetylation.
Author: ZhangMeiTing
Session Name: Eif2b5_H3K18la
Genome Assembly: mm10
Creation Date: 2023-12-03
Views: 549 		1701590400 549
Description: A snapshot from the genome browser displaying the enrichment of H3K18la in the replicates of the two groups, with and without sodium lactate.Yanhua Zhao, Meiting Zhang, Xingwei Huang, Jiqiang Liu, Yuchen Sun, Fan Zhang, Na Zhang and Lei Lei Lactate modulates zygotic genome activation though H3K18 lactylation rather than H3K27 acetylation.
Author: ZhangMeiTing
Session Name: H3K18la
Genome Assembly: mm10
Creation Date: 2023-12-03
Views: 558 		1701590400 558
Description: The UCSC Browser show the enrichment of the H3K18la signal of Dppa2 in both +L and -L groups.Yanhua Zhao, Meiting Zhang, Xingwei Huang, Jiqiang Liu, Yuchen Sun, Fan Zhang, Na Zhang and Lei Lei Lactate modulates zygotic genome activation though H3K18 lactylation rather than H3K27 acetylation.
Author: ZhangMeiTing
Session Name: Dppa2_H3K18la
Genome Assembly: mm10
Creation Date: 2023-12-03
Views: 556 		1701590400 556
Description: ZC3 ChIP
Author: yannfrey
Session Name: ZC3 ChIP
Genome Assembly: hg38
Creation Date: 2023-11-26
Views: 705 		1700985600 705
Description: CTCF loops, Oxford nanopore phased methylation and RNAseq in LUHMES cell line for the 15q11-q13 region. Zoomed in view of the MAGEL2 anchor region as shown in Figure 9A of Gutierrez Fugon et al, Human Molecular Genetics, 2024.
Author: ojg333
Session Name: MAGEL2_Fig9A _Fugon_2024
Genome Assembly: hg19
Creation Date: 2024-07-22
Views: 378 		1721635200 378
Description: RNA omics stuff
Author: nrpowell
Session Name: 2023_Nov_CYP3A4_fold/m6a/eclip_comparison
Genome Assembly: hg38
Creation Date: 2023-11-20
Views: 849 		1700467200 849
Description: Tdg&p53
Author: shaozhenyu2017@sibcb.ac.cn
Session Name: Tdg&p53
Genome Assembly: mm10
Creation Date: 2023-11-18
Views: 551 		1700294400 551
Description: PDE6C&RBP4
Author: gracewattawa
Session Name: PDE6C&RBP4
Genome Assembly: mm9
Creation Date: 2023-11-14
Views: 581 		1699948800 581
Description: p
Author: julianna0220
Session Name: PDE6C
Genome Assembly: mm9
Creation Date: 2023-11-14
Views: 634 		1699948800 634
Description: GUCA1B&GUCA1A
Author: gracewattawa
Session Name: GUCA1B&GUCA1A
Genome Assembly: mm9
Creation Date: 2023-11-14
Views: 448 		1699948800 448
Description: d
Author: julianna0220
Session Name: GUCA1B
Genome Assembly: mm9
Creation Date: 2023-11-14
Views: 577 		1699948800 577
Description: mm9 PDE6C/RBP4 Multiomics
Author: chelseadonovan
Session Name: mm9 PDE6C/RBP4 Multiomics
Genome Assembly: mm9
Creation Date: 2023-11-14
Views: 564 		1699948800 564
Description: NRL&CPNE6
Author: gracewattawa
Session Name: NRL&CPNE6
Genome Assembly: mm9
Creation Date: 2023-11-14
Views: 420 		1699948800 420
Description: d
Author: julianna0220
Session Name: cone6
Genome Assembly: mm9
Creation Date: 2023-11-14
Views: 594 		1699948800 594
Description: nrl version of everything
Author: joshraynes
Session Name: Nrl version
Genome Assembly: mm9
Creation Date: 2023-11-14
Views: 583 		1699948800 583
Description: RHO&H1foo
Author: gracewattawa
Session Name: RHO&H1foo rnaseq
Genome Assembly: mm9
Creation Date: 2023-11-14
Views: 391 		1699948800 391
Description: pho
Author: julianna0220
Session Name: RHO Pho
Genome Assembly: mm9
Creation Date: 2023-11-14
Views: 559 		1699948800 559
Description: mm9 GUCA1B/GUCA1A Multiomics
Author: chelseadonovan
Session Name: mm9 GUCA1B/GUCA1A Multiomics
Genome Assembly: mm9
Creation Date: 2023-11-14
Views: 532 		1699948800 532
Description: mm9 NRL/CPNE6 Multiomics
Author: chelseadonovan
Session Name: mm9 NRL/CPNE6 Multiomics
Genome Assembly: mm9
Creation Date: 2023-11-14
Views: 564 		1699948800 564
Description: RNASEQnrl
Author: gracewattawa
Session Name: RNASEQnrl
Genome Assembly: mm9
Creation Date: 2023-11-14
Views: 557 		1699948800 557
Description: mm9 RHO Multiomics
Author: chelseadonovan
Session Name: mm9 RHO Multiomics
Genome Assembly: mm9
Creation Date: 2023-11-14
Views: 571 		1699948800 571
Description: BINF6310
Author: varun1010
Session Name: hg38_assignment7_1
Genome Assembly: hg38
Creation Date: 2023-11-12
Views: 604 		1699776000 604
Description: RCVRN gene
Author: Isabella Lindblad
Session Name: 11-9_mouse3_RCVRN
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 593 		1699516800 593
Description: mm9 RCVRN CBR sites
Author: chelseadonovan
Session Name: mm9 RCVRN CBR sites
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 576 		1699516800 576
Description: RCVRN
Author: kenzie.prettyman
Session Name: RCVRN
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 584 		1699516800 584
Description: rcvrn
Author: julianna0220
Session Name: RCVRN
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 571 		1699516800 571
Description: HTT
Author: kenzie.prettyman
Session Name: HTT
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 635 		1699516800 635
Description: mm9 HTT CBR sites
Author: chelseadonovan
Session Name: mm9 HTT CBR sites
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 559 		1699516800 559
Description: HTT
Author: julianna0220
Session Name: HTT
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 592 		1699516800 592
Description: CRX binding regions of PDE6A
Author: taylo2ga
Session Name: Mouse PDE6A
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 568 		1699516800 568
Description: THRB
Author: kenzie.prettyman
Session Name: THRB
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 607 		1699516800 607
Description: thrb
Author: julianna0220
Session Name: THRB
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 584 		1699516800 584
Description: mm9 THRB CBR sites
Author: chelseadonovan
Session Name: mm9 THRB CBR sites
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 594 		1699516800 594
Description: PDE6A
Author: kenzie.prettyman
Session Name: PDE6A
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 577 		1699516800 577
Description: RHO nrl- onlh
Author: joshraynes
Session Name: RHO Nrl-
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 537 		1699516800 537
Description: PDE6A
Author: julianna0220
Session Name: PDE6A
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 584 		1699516800 584
Description: mm9 PDE6A CBR sites
Author: chelseadonovan
Session Name: mm9 PDE6A CBR sites
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 573 		1699516800 573
Description: Viewing Mouse Genome 2007 (mm9), RHO gene with CRX binding sites
Author: chelseadonovan
Session Name: mm9 RHO CBR sites
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 589 		1699516800 589
Description: crx binding
Author: julianna0220
Session Name: CRX JP
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 576 		1699516800 576
Description: CBR data in PDE6A gene on mouse mm9 genome
Author: ryleestrother
Session Name: CBR PDE6A mm9
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 556 		1699516800 556
Description: CBR regions of the RCVRN gene
Author: taylo2ga
Session Name: Mouse RCVRN
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 561 		1699516800 561
Description: crx binding sites
Author: gracewattawa
Session Name: CRX binding sites
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 575 		1699516800 575
Description: CRX binding regions of the gene HTT
Author: taylo2ga
Session Name: Mouse HTT
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 576 		1699516800 576
Description: CRX binding sites wt and mutant
Author: kenzie.prettyman
Session Name: CRX
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 620 		1699516800 620
Description: Enke Bio481 THRB Gene in mm9
Author: cooperki
Session Name: THRB_Mouse
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 607 		1699516800 607
Description: RHO gene
Author: Isabella Lindblad
Session Name: 11-9_mouse_RHO
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 544 		1699516800 544
Description: CRX binding regions of the THRB gene
Author: taylo2ga
Session Name: Mouse THRB
Genome Assembly: mm9
Creation Date: 2023-11-09
Views: 543 		1699516800 543
Description: binf6310 hg38 custom track
Author: sydneycole
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2023-11-05
Views: 721 		1699171200 721
Description: test.bed custom tracks
Author: rpatel01
Session Name: binfmodule7
Genome Assembly: hg38
Creation Date: 2023-11-03
Views: 966 		1698998400 966
Description: BINF6310 MODULE 7
Author: Pruthweish27
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2023-10-31
Views: 880 		1698739200 880
Description: BINF6310 MODULE 7
Author: sreepoojitha
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2023-11-02
Views: 608 		1698912000 608
Description: ancestry - taster nontaster
Author: fareehaa_ahm
Session Name: ancestry
Genome Assembly: hg19
Creation Date: 2023-11-02
Views: 579 		1698912000 579
Description: hg19 TAS2R38 Ancestry Data
Author: chelseadonovan
Session Name: hg19 TAS2R38 Ancestry Data
Genome Assembly: hg19
Creation Date: 2023-11-02
Views: 571 		1698912000 571
Description: ancestry
Author: julianna0220
Session Name: Ancestry.com
Genome Assembly: hg19
Creation Date: 2023-11-02
Views: 570 		1698912000 570
Description: Ancestry.com SNPs
Author: ryleestrother
Session Name: hg19 ancestry.com
Genome Assembly: hg19
Creation Date: 2023-11-02
Views: 529 		1698912000 529
Description: Ancestry.com data
Author: kenzie.prettyman
Session Name: Ancestry.com
Genome Assembly: hg19
Creation Date: 2023-11-02
Views: 573 		1698912000 573
Description: custom tracks - BIO 481
Author: fareehaa_ahm
Session Name: MYBPC1_customtracks_Fareeha
Genome Assembly: hg19
Creation Date: 2023-11-02
Views: 597 		1698912000 597
Description: MYBPC1
Author: julianna0220
Session Name: MYBPC1 JP
Genome Assembly: hg19
Creation Date: 2023-11-02
Views: 559 		1698912000 559
Description: Final with descriptions
Author: rahrigHK
Session Name: MYBPC1 Activity (Final)
Genome Assembly: hg19
Creation Date: 2023-11-02
Views: 558 		1698912000 558
Description: MYBPC1 session
Author: joshraynes
Session Name: MYBPC1
Genome Assembly: hg19
Creation Date: 2023-11-02
Views: 567 		1698912000 567
Description: MYBPC1 assignment
Author: kenzie.prettyman
Session Name: MYBPC1
Genome Assembly: hg19
Creation Date: 2023-11-02
Views: 606 		1698912000 606
Description: hg19 assembly showing MYBPC1 gene & custom tracks
Author: chelseadonovan
Session Name: hg19 MYBPC1
Genome Assembly: hg19
Creation Date: 2023-11-02
Views: 580 		1698912000 580
Description: BINF_6310 Module 7
Author: kandalkarankita
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2023-11-02
Views: 569 		1698912000 569
Description: BINF-6310
Author: Harshini144
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2023-11-02
Views: 564 		1698912000 564
Description: BINF 6310 Module 7
Author: nallaboluvikas
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2023-11-01
Views: 1246 		1698825600 1246
Description: Custom tracks for genomic variants on chr22
Author: sdzzwzy
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2023-11-01
Views: 575 		1698825600 575
Description: BINF6310
Author: SaradaPriya_Mns
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2023-10-31
Views: 813 		1698739200 813
Description: binf6310
Author: varun1010
Session Name: hg38_assignment7
Genome Assembly: hg38
Creation Date: 2023-10-31
Views: 682 		1698739200 682
Description: BINF 6310
Author: Pavitra Dass
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2023-10-31
Views: 575 		1698739200 575
Description: BINF6310
Author: Meghana09
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2023-10-31
Views: 672 		1698739200 672
Description: custom link for assignment7
Author: srivastava.sank
Session Name: assignment7track
Genome Assembly: hg38
Creation Date: 2023-10-31
Views: 577 		1698739200 577
Description: DAG session
Author: DaniGonzalez
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2024-10-31
Views: 323 		1730361600 323
Description: Incorporating a customized track
Author: Tanvi
Session Name: test
Genome Assembly: hg38
Creation Date: 2023-10-31
Views: 634 		1698739200 634
Description: BINF6310 Assignment: Incorporating a customized track using the provided bed file into the UCSC Genome Browser. Submitted by AashkaB
Author: aashka.b
Session Name: test_session_AB
Genome Assembly: hg38
Creation Date: 2023-10-31
Views: 591 		1698739200 591
Description: This is a session run as a part of assignment for the course BINF6310
Author: Unnati Jonnavithula
Session Name: UJ1
Genome Assembly: hg38
Creation Date: 2023-10-31
Views: 557 		1698739200 557
Description: this is the assignment
Author: yuqiaotang
Session Name: 6300assignment7
Genome Assembly: hg38
Creation Date: 2023-10-31
Views: 611 		1698739200 611
Description: Module 7 - BIF6310
Author: trangtu97
Session Name: hg38_human
Genome Assembly: hg38
Creation Date: 2023-10-30
Views: 588 		1698652800 588
Description: test for school
Author: tojaga.m
Session Name: Eosinophil
Genome Assembly: hg38
Creation Date: 2023-10-26
Views: 579 		1698307200 579
Description: Trout
Author: Rafet
Session Name: ChromHmm
Genome Assembly: hub_2243217_GCF_013265735.2
Creation Date: 2023-10-25
Views: 77 		1698220800 77
Description: Harvard MCB197 course, histone modifications in human tissues
Author: amandajoyward
Session Name: MCB197-histone
Genome Assembly: hg38
Creation Date: 2023-10-20
Views: 573 		1697788800 573
Description: hg38 Blat of in situ hybridization probes to NTRK2.
Author: amandajoyward
Session Name: MCB197-NTRK2 probes
Genome Assembly: hg38
Creation Date: 2023-10-30
Views: 554 		1698652800 554
Description: BINF 6310
Author: pavan kumar
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2023-10-30
Views: 559 		1698652800 559
Description: Quiz 10/12
Author: jschifflin
Session Name: HTT gene assignment
Genome Assembly: hg38
Creation Date: 2023-10-12
Views: 885 		1697097600 885
Description: hg38 HTT gene BIO481 - 10/12/23
Author: fareehaa_ahm
Session Name: hg38_HTT
Genome Assembly: hg38
Creation Date: 2023-10-12
Views: 746 		1697097600 746
Description: hg38 genome viewing HTT gene with GENCODE V32 and Simple Repeats
Author: chelseadonovan
Session Name: hg38 HTT gene
Genome Assembly: hg38
Creation Date: 2023-10-11
Views: 1111 		1697011200 1111
Description: htt gene
Author: julianna0220
Session Name: hg38 HTT gene
Genome Assembly: hg38
Creation Date: 2023-10-11
Views: 632 		1697011200 632
Description: haethethntgnarangr
Author: jrkenne
Session Name: hg19_hbg
Genome Assembly: hg19
Creation Date: 2023-10-02
Views: 893 		1696233600 893
Description: Hemoglobin
Author: Biniyam
Session Name: hg19_hemoglobin
Genome Assembly: hg19
Creation Date: 2023-09-28
Views: 751 		1695888000 751
Description: The genes HBB and HBD are both expressed in red blood cells, but HBB is also expressed in many other tissues, whereas HBD in expressed in red blood cells almost exclusively.
Author: laparidis.e
Session Name: hg19_hemoglobin
Genome Assembly: hg19
Creation Date: 2023-11-05
Views: 584 		1699171200 584
Description: Methylation data for human and mouse
Author: masarun
Session Name: masa_test
Genome Assembly: hg38
Creation Date: 2023-09-21
Views: 1165 		1695283200 1165
Description: BAF and histone markers in SS mouse model
Author: Li Li
Session Name: mouse_SS_BAF_histoneMarkers
Genome Assembly: mm10
Creation Date: 2024-06-27
Views: 427 		1719475200 427
Description: Chip seq
Author: xiaopei
Session Name: Chip_seq_A
Genome Assembly: hg38
Creation Date: 2024-06-27
Views: 396 		1719475200 396
Description: Microsatellites Density Landscape (Main track) Including sub-tracks: Landscape of STR Density, HMDP, MMDP, LMDP Description: The landscapes illustrated the relative density of local microsatellites per kilobase of sequence along the comprehensive reference Human Genome GRCh38 , indicating that microsatellites tend to aggregate in a characteristic manner, resulting in numerous peaks of microsatellite density throughout the genome. These microsatellite density peaks can be categorized into three distinct types: High Microsatellite Density Peak (HMDP), Middle Microsatellite Density Peak (MMDP), and Low Microsatellite Density Peak (LMDP). Therefore, the main track contains four sub-tracks which are Landscape of STR Density, HMDP, MMDP, LMDP. Methods: Each chromosome sequence of GRCh38 was divided into a large number of units (bins) by the differential method with a resolution of 1kb. The local microsatellite relative density in every 1kb resolution unit was referred as position-related Differential-unit1kb (D1) Relative Density (pD1RD) and calculated by formula: pD1RDi = mi/1kb × 1000. Track statistics summary: Genome Assembled Size (bp): 3,088,269,832 Total peak count: 208,638 HMDP count: 3,480 MMDP count: 26,310 LMDP count: 178,848 Session Name: Microsatellite Density Landscape References: Xia Y, Li D, Chen T, Pan S, Huang H, Zhang W, Liang Y, Fu Y, Peng Z, Zhang H et al. Microsatellite density landscapes illustrate short tandem repeats aggregation in the complete reference human genome. BMC Genomics. 2024; 25(1):960. PMID: 39402450; DOI: 10.1186/s12864-024-10843-9 Li D, Pan S, Zhang H, Fu Y, Peng Z, Zhang L, et al. A comprehensive microsatellite landscape of human Y-DNA at kilobase resolution. BMC genomics. 2021; 22(1):76. PMID: 33482734; PMCID: PMC7821415
Author: zhongyangtan
Session Name: GRCh38.p14
Genome Assembly: hg38
Creation Date: 2023-09-10
Views: 1593 		1694332800 1593
Description: zoom in PBK and find out all the upstream 200base SNPs
Author: ZhengJi
Session Name: hg38_upstream200SNPs
Genome Assembly: hg38
Creation Date: 2023-09-05
Views: 1252 		1693900800 1252
Description: probes for FISH on human cells and tissues
Author: rafal.czapiewski@ed.ac.uk
Session Name: hg19_FISH_probes
Genome Assembly: hg19
Creation Date: 2024-01-17
Views: 571 		1705478400 571
Description: Crouch DRIP-Seq rDNA annotations
Author: apratim.mitra
Session Name: crouch-dripseq-rdna-annotations-diff
Genome Assembly: hub_4200124_mm10
Creation Date: 2023-08-31
Views: 280 		1693468800 280
Description: class 3
Author: hekn
Session Name: “Fall23 Worm BIO481 group 3
Genome Assembly: ce11
Creation Date: 2023-08-31
Views: 652 		1693468800 652
Description: Beginner Activity for UCSC Genome Browser (BIO481)
Author: fareehaa_ahm
Session Name: Fall23 Worm BIO481 group4
Genome Assembly: ce11
Creation Date: 2023-08-31
Views: 693 		1693468800 693
Description: genomic 481 in class activity
Author: ryleestrother
Session Name: Fall23 Yeast BIO481 group2
Genome Assembly: sacCer3
Creation Date: 2023-08-31
Views: 604 		1693468800 604
Description: Group Activity #1 from Group 1.
Author: jschifflin
Session Name: Fall23 Yeast BIO481 Group1
Genome Assembly: sacCer3
Creation Date: 2023-08-31
Views: 622 		1693468800 622
Description: group 5 version of mouse project
Author: julianna0220
Session Name: Fall23 Mouse481 group5
Genome Assembly: mm9
Creation Date: 2023-08-31
Views: 590 		1693468800 590
Description: Mouse genome group project group 6
Author: joshraynes
Session Name: Fall23 MouseBio481 Group 6
Genome Assembly: mm9
Creation Date: 2023-08-31
Views: 564 		1693468800 564
Description: Mouse genome (mm9) for Group #6 in BIO481
Author: chelseadonovan
Session Name: Fall23 Mouse BIO481 Genome Group#6
Genome Assembly: mm9
Creation Date: 2023-08-31
Views: 415 		1693468800 415
Description: The genes HBB and HBD are both expressed in red blood cells, but HBB is also expressed in many other tissues, whereas HBD is expressed in red cells almost exclusively.
Author: shancon1200
Session Name: hg19_hemoglobin
Genome Assembly: hg19
Creation Date: 2023-08-31
Views: 600 		1693468800 600
Description: Show every Lysine site on POMC 1st extron on hg38.
Author: ZhengJi
Session Name: hg38_POMC1stextronK
Genome Assembly: hg38
Creation Date: 2023-08-31
Views: 611 		1693468800 611
Description: hg18_rnaseq3
Author: hyfydky
Session Name: hg18_rnaseq3
Genome Assembly: hg18
Creation Date: 2024-05-20
Views: 435 		1716192000 435
Description: BTD MANE in HG38 UCSC browser
Author: lilinatera
Session Name: hg38_BTD_MANE
Genome Assembly: hg38
Creation Date: 2023-08-27
Views: 746 		1693123200 746
Description: Clinically relevant pesudogenes sequences [high homology: orange; low homology: light orange, as per Mandelker et al. 2016; PMID: 27228465. Example: ALG1_0.26_241_1_241; Gene Name _ Mappability _ Positions <1 _ % Positions <1 _ Max contiguous bases; the 'ALG1' gene feature at position chr16:5127843-5128083, Exon+/-65bp has a 'Mappabilty score' of 0.26 (1= mapping only once to the genome whereas a score lower than 1 equates to homology else where on the genome. 241 'Positions' (bases) affected, 100'% of these Positions' and 241 'Max contiguous bases' within the Exon+/-65bp that are affected as indicated by having a mappability score below 1.
Author: Yog77
Session Name: hg19_ClinicalHomology
Genome Assembly: hg19
Creation Date: 2017-01-17
Views: 1897 		1484640000 1897
Description: Archaic introgression identified with the use of hmmix by Skov et al., (https://github.com/LauritsSkov/Introgression-detection). Genotype data from 1000 genomes projects.
Author: daxa213
Session Name: hg19_SkovHMM_GBR_CHS
Genome Assembly: hg19
Creation Date: 2023-08-23
Views: 311 		1692777600 311
Description: 2
Author: jschifflin
Session Name: hg19 RHO 2
Genome Assembly: hg19
Creation Date: 2023-09-05
Views: 619 		1693900800 619
Description: This session is a view of the 10 capstone genes in the SSPsyGene project. It uses the multi-region tool to slice the genome over several chromosomes to display all the genes in one view. Capstone genes:ARID1B ASXL3 CACNA1G CHD8 DLL1 GABRA1 KMT2C SCN2A SHANK3 SMARCC2
Author: brianlee
Session Name: Capstone_Genes
Genome Assembly: hg38
Creation Date: 2023-08-15
Views: 1363 		1692086400 1363
Description: This session is a view of the 10 capstone genes in the SSPsyGene project in order of chromosomes (a gene on chr2 before the gene on chr5). It uses the multi-region tool to slice the genome over several chromosomes to display all the genes in one view. Capstone genes:SCN2A GABRA1 DLL1 ARID1B KMT2C SMARCC2 CHD8 CACNA1G ASXL3 SHANK3
Author: brianlee
Session Name: CapstoneGenes
Genome Assembly: hg38
Creation Date: 2023-08-15
Views: 749 		1692086400 749
Description: Testing public session
Author: gperez2
Session Name: Testing_public_session
Genome Assembly: hg38
Creation Date: 2023-08-03
Views: 697 		1691049600 697
Description: BioInf 6310 bed file upload
Author: Neveen Mohamed
Session Name: nv23
Genome Assembly: hg38
Creation Date: 2023-10-31
Views: 603 		1698739200 603
Description: ATAC-seq pile-up tracks for fruit fly clock neurons. For more details and citation: https://doi.org/10.1101/2023.08.15.553315
Author: yegeyy
Session Name: ATAC wildtype and per01 pile-up tracks
Genome Assembly: dm6
Creation Date: 2023-08-08
Views: 625 		1691481600 625
Description: Test
Author: gperez2
Session Name: brca1
Genome Assembly: hg38
Creation Date: 2023-10-27
Views: 594 		1698393600 594
Description: E5ind and NF54-GEXP02-Tom H3K9me3 dynamics at the onset of gam. dev.
Author: sandracula
Session Name: H3K9me3 dynamics at the onset of gam. dev.
Genome Assembly: hub_2790993_GCA_000002765.3
Creation Date: 2024-03-12
Views: 497 		1710230400 497
Description: d
Author: julianna0220
Session Name: hg19 RHO JP
Genome Assembly: hg19
Creation Date: 2023-09-04
Views: 585 		1693814400 585
Description: eclip comparison 2023
Author: nrpowell
Session Name: eCLIP_comparison_May_2023
Genome Assembly: hg38
Creation Date: 2023-05-23
Views: 2591 		1684828800 2591
Description: This custom session includes manually selected blood-related DNA methylation data measured by bisulfite sequencing. This initial session include 121 tracks updated until 2023 June.
Author: dai905
Session Name: hg38_bloodcell_121
Genome Assembly: hg38
Creation Date: 2023-06-02
Views: 592 		1685692800 592
Description: rs142783062
Author: nrpowell
Session Name: rs142783062
Genome Assembly: hg38
Creation Date: 2023-06-01
Views: 2215 		1685606400 2215
Description: Epigenetic selectivity of TopoIIα redistribution and histone eviction of anthracyclines Anthracyclines act by disrupting the interface of TopoII and DNA and by evicting histones. The anthracycline-specific redistribution of TopoII and its association with histone eviction were addressed in K562 cells. Chromatin immunoprecipitation, followed by deep sequencing (ChIP-seq) against endogenously tagged TopoIIα, and transposase-accessible chromatin with sequencing (ATAC-seq) was performed 4 hours after anthracycline exposure.
Author: mtan1
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2023-08-11
Views: 655 		1691740800 655
Description: Data Viewer
Author: allenbellamom
Session Name: hg38_DC
Genome Assembly: hg38
Creation Date: 2023-10-25
Views: 590 		1698220800 590
Description: GR ChIP
Author: tsuzuki
Session Name: PC_hg38
Genome Assembly: hg38
Creation Date: 2023-05-17
Views: 2370 		1684310400 2370
Description: This session describes the genomic location for LD-SNPs of rs7255249 (r2>0.8). (Top) The plot shows the eQTL association of local variants with CHST8 expression in breast mammary tissues. (Middle) GeneHancer track shows probable interactions between regulatory elements and CHST8 promoter. (Bottom) DHS region, H3K4me1, H3K4me3, and H3K27ac marks present putative epigenetic regulation. DHS signals of each cells are from ENCODE. Histone modification signals of MCF7, HMEC-1 (mammary epithelial cell, 50-year-old female), and HMEC-2 (breast epithelium, 51-year-old female) are also from ENCODE, whereas histone modification results of vHMEC (Breast_vHMEC.Donor_RM035) and BMC (Breast_Myoepithelial_Cells) are from Roadmap Epigenomics. Histone modification signals from different biosamples are grouped in order by H3K4me3, H3K4me1, and H3K27ac and presented them as overlaid tracks.
Author: Wen-Cheng
Session Name: Breast_rs7255249
Genome Assembly: hg19
Creation Date: 2023-05-18
Views: 599 		1684396800 599
Description: UCSC browser session associated with manuscript: PMID: 38032818 Title: Chromosome-specific maturation of the epigenome in the Drosophila male germline
Author: jamesanderson12358
Session Name: analysis230508___UCSC_session_germline_MS
Genome Assembly: dm6
Creation Date: 2023-05-08
Views: 724 		1683532800 724
Description: inputA.bed and inputA.bedgraph
Author: amykle
Session Name: inputA from usr 16
Genome Assembly: hg38
Creation Date: 2023-05-04
Views: 874 		1683187200 874
Description: hugo example RTS
Author: Example
Session Name: hg38_hugo2023
Genome Assembly: hg38
Creation Date: 2023-05-04
Views: 830 		1683187200 830
Description: Mouse meth
Author: danilapror
Session Name: mm10
Genome Assembly: mm10
Creation Date: 2023-05-04
Views: 916 		1683187200 916
Description: OMICS_HW_2_Sokolov_AA
Author: hazirliver1
Session Name: mm10_Sokolov_AA
Genome Assembly: mm10
Creation Date: 2023-05-03
Views: 841 		1683100800 841
Description: WGBS and RNA-seq data from ENCODE - T cells - GN12878 - NK - Pancr end_OTHERS Looking at gene CD55!
Author: michalula
Session Name: WGBS_RNA_ENCODE_T_GN12878_NK_Pancr_end_OTHERS_CD55
Genome Assembly: hg38
Creation Date: 2023-05-01
Views: 1160 		1682928000 1160
Description: dnasel
Author: aehodges
Session Name: mm9/3.4.25
Genome Assembly: mm9
Creation Date: 2025-03-04
Views: 207 		1741075200 207
Description: PSIP ChIP (GSE175482)
Author: tsuzuki
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2023-04-09
Views: 1355 		1681027200 1355
Description: Gene project for genetics class
Author: bji20
Session Name: Gene Project Final
Genome Assembly: hg38
Creation Date: 2023-04-07
Views: 1076 		1680854400 1076
Description: Tracks from GSE212386. Titration of H3K9me3 and H3K27ac antibodies in ChIP, as well as replicates of H3K9me2 IPs.
Author: ari11
Session Name: GSE212386
Genome Assembly: hg38
Creation Date: 2023-04-05
Views: 1026 		1680681600 1026
Description: CUT&RUN data for "Stress increases sperm respiration and motility in mice and men." Numbers in the sample names are associated with treatment condition as follows: Vehicle: 4, 5, 10, 12 Cort: 2, 3, 7, 8, 9
Author: nickole.kanyuch
Session Name: CUT&RUN_NM_03-2023
Genome Assembly: mm10
Creation Date: 2023-03-28
Views: 274 		1679990400 274
Description: BS assay and gRNA tracks for ATRT synthetic lethal candidate genes
Author: matejboros
Session Name: hg19_custom_track
Genome Assembly: hg19
Creation Date: 2023-03-07
Views: 1269 		1678176000 1269
Description: This is the session showing the location and expression of the new junction that might cause frame shift.
Author: dandan_0909
Session Name: hg38_5_26
Genome Assembly: hg38
Creation Date: 2025-05-26
Views: 309 		1748246400 309
Description: Tissue-level Atlas of Mouse Isoforms. We used full-length cDNA sequencing and the Mandalorion tool to identify and quantify high confidence transcript Isoforms for a variety of mouse tissues
Author: vollmers
Session Name: TAMI
Genome Assembly: mm39
Creation Date: 2024-01-25
Views: 1197 		1706169600 1197
Description: gene_expression_GM12878
Author: rafal.czapiewski@ed.ac.uk
Session Name: hg19_expression_GM12878
Genome Assembly: hg19
Creation Date: 2023-01-24
Views: 1467 		1674547200 1467
Description: these are the 4 variants to show bruce CTs in sessions
Author: cincinnati2023
Session Name: hg38_4vars
Genome Assembly: hg38
Creation Date: 2023-01-26
Views: 854 		1674720000 854
Description: Wyatt Dano Bioinformatics hands on session gene public session
Author: wpd20
Session Name: MCR1 Gene
Genome Assembly: hg38
Creation Date: 2023-10-23
Views: 570 		1698048000 570
Description: Human Chromosome 22 from the Human Genome Consortium build 38 (the latest annotated reference assembly of the human genome)
Author: elittlestone
Session Name: HGC/38
Genome Assembly: hg38
Creation Date: 2023-10-23
Views: 555 		1698048000 555
Description: tRNA
Author: ck-j
Session Name: tRNA
Genome Assembly: hg38
Creation Date: 2022-12-16
Views: 856 		1671177600 856
Description: hg19 RHO gene with Multiz Allignments and Basewise Conservation (phyloP)
Author: chelseadonovan
Session Name: hg19 RHO Multiz Alignments
Genome Assembly: hg19
Creation Date: 2023-09-05
Views: 600 		1693900800 600
Description: ChIP-seq of Histone 3 Acetylation (H3ac) marks.
Author: HanZhang-
Session Name: H3ac_ChIP
Genome Assembly: hg38
Creation Date: 2023-08-11
Views: 538 		1691740800 538
Description: This data has been made public to provide access to peer reviewers
Author: VetrieLab
Session Name: BV173 ChIP Datasets_Scott et al
Genome Assembly: hg38
Creation Date: 2022-11-15
Views: 788 		1668499200 788
Description: BALB/c mouse tissue level transcriptome atlas
Author: msadams
Session Name: BALB/c mouse transcriptome
Genome Assembly: mm39
Creation Date: 2022-08-09
Views: 865 		1660032000 865
Description: Contribution tracks for peak 2
Author: lacey.walker
Session Name: peak2
Genome Assembly: hg38
Creation Date: 2022-10-15
Views: 2904 		1665820800 2904
Description: Contribution tracks for peak 0
Author: lacey.walker
Session Name: peak0
Genome Assembly: hg38
Creation Date: 2022-10-15
Views: 1813 		1665820800 1813
Description: Contribution tracks for peak 1
Author: lacey.walker
Session Name: peak1
Genome Assembly: hg38
Creation Date: 2022-10-15
Views: 903 		1665820800 903
Description: Genome-wide characterization of mitochondrial DNA methylation in human brain. Matthew Devall1, Darren M. Soanes, Adam R. Smith, Emma L. Dempster, Rebecca G. Smith, Joe Burrage, Artemis Iatrou, Eilis Hannon, Claire Troakes, Karen Moore, Paul O’Neill, Safa Al-Sarraj, Leonard Schalkwyk, Jonathan Mill, Michael Weedon & Katie Lunnon The mitochondrial genome is characterized by specific regions of methylation. Graph showing average % methylation at each cytosine in the mitochondrial genome from superior temporal gyrus (STG) and cerebellum (CER) brain tissue from seven donors free of neurodegenerative disease, including three males and four females using a targeted bisulfite sequencing method.
Author: dmsoanes
Session Name: chrM_methylation_STG_CER
Genome Assembly: hg38
Creation Date: 2022-10-04
Views: 1025 		1664870400 1025
Description: Used for CMSE 411
Author: CVan0124
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2022-09-23
Views: 818 		1663920000 818
Description: HIV-1 strain NL4-3 mRNA Atlas v1 mRNA transcript models open reading frames (ORFs) mapped onto HIV-1 RefSeq:NC_001802.1. Author: Alejandro Gener. Contact: itspronouncedhenner@gmail.com Transcript model method: Transcript models were downloaded as FASTA from GenBank:MZ242719.1-MZ242757.1 were blat (sic) against NC_001802.1 (GCF_000864765.1) in UCSC. Max number of sequences for blat = 25, so n=38 was partitioned into two blat runs, sorted by accession. These were viewed as a track in UCSC Genome Browser. MZ242719.1, MZ242720.1, MZ242721.1 are models of unspliced, singly-spliced, and doubly-spliced. "Singly-spliced" and "doubly-spliced" have been commonly used in the literature, but without basis in explicitly defined mRNA models. As you can see, HIV-1 NL4-3 splice isoforms supported by high-quality long reads and reanalysis are more complicated that previously understood. Open reading frames (ORFs) method: Coding features were downloaded as FASTA from GenBank:MZ242719.1 were blat (sic) against NC_001802.1 (GCF_000864765.1) in UCSC. These were viewed as a track in UCSC Genome Browser. ORF note 1: Exact ranges for GENER10 and GENER12 differ because of apparent sequence differences at their start codons. This is because blat did not match the small leading exon 5'-ATGGCAG-3' which spans NC_001802.1:4599-4605. This exon is supported by long-read mRNA of NL4-3 infected and transfected cells. ORF note 2: Small regions of homology overlap polypurine tracts important for viral replication. These are not ORFs. ORF note 3: MZ242719.1 (NL4-3) and NC_001802.1 are both HIV-1 subgroup B viruses. NL4-3 is a synthetic chimeric virus reviewed elsewhere. However, it is the most common strain of HIV used in laboratory settings. Both are modeled as "R-U5-HIV-U3-R". If using the NL4-3 mRNA Atlas v1, please cite: 1.) Gener, A. R. (2022). Anticipating HIV drug resistance with appropriate sequencing methods. AIDS, 36(1). https://journals.lww.com/aidsonline/Fulltext/2022/01010/Anticipating_HIV_drug_resistance_with_appropriate.16.aspx. 2.) Gener, A. R., Klotman, P. E., Danesh, F. R., Cijiang He, J., Kimata, J. T., Lupski, J. R., & Ross, M. J. (2021). HIV informatics . Baylor College of Medicine Integrative Molecular and Biomedical Sciences Graduate Program.
Author: gener
Session Name: GCF_000864765.1_HIV-1_mRNA_Atlas_v1_blat_mRNA+ORFs
Genome Assembly: hub_3521609_GCF_000864765.1
Creation Date: 2022-09-21
Views: 622 		1663747200 622
Description: HIV-1 strain NL4-3 mRNA Atlas v1 open reading frames (ORFs) mapped onto HIV-1 RefSeq:NC_001802.1. Author: Alejandro Gener. Contact: itspronouncedhenner@gmail.com Method: Coding features were downloaded as FASTA from GenBank:MZ242719.1 were blat (sic) against NC_001802.1 (GCF_000864765.1) in UCSC. These were viewed as a track in UCSC Genome Browser. Note 1: Exact ranges for GENER10 and GENER12 differ because of apparent sequence differences at their start codons. This is because blat did not match the small leading exon 5'-ATGGCAG-3' which spans NC_001802.1:4599-4605. This exon is supported by long-read mRNA of NL4-3 infected and transfected cells. Note 2: Small regions of homology overlap polypurine tracts important for viral replication. These are not ORFs. Note 3: MZ242719.1 (NL4-3) and NC_001802.1 are both HIV-1 subgroup B viruses. NL4-3 is a synthetic chimeric virus reviewed elsewhere. However, it is the most common strain of HIV used in laboratory settings. Both are modeled as "R-U5-HIV-U3-R". If using the NL4-3 mRNA Atlas v1, please cite: 1.) Gener, A. R. (2022). Anticipating HIV drug resistance with appropriate sequencing methods. AIDS, 36(1). https://journals.lww.com/aidsonline/Fulltext/2022/01010/Anticipating_HIV_drug_resistance_with_appropriate.16.aspx. 2.) Gener, A. R., Klotman, P. E., Danesh, F. R., Cijiang He, J., Kimata, J. T., Lupski, J. R., & Ross, M. J. (2021). HIV informatics . Baylor College of Medicine Integrative Molecular and Biomedical Sciences Graduate Program.
Author: gener
Session Name: GCF_000864765.1_HIV-1_mRNA_Atlas_v1_blat_ORFs
Genome Assembly: hub_3521609_GCF_000864765.1
Creation Date: 2022-09-20
Views: 1159 		1663660800 1159
Description: This session is used for CNV interpretation
Author: JZhaoARUP
Session Name: hg38_ARUP_CMA_multi_gene
Genome Assembly: hg38
Creation Date: 2022-09-19
Views: 1363 		1663574400 1363
Description: This session is used for CNV interpretation
Author: JZhaoARUP
Session Name: hg38_ARUP_CMA_single_gene
Genome Assembly: hg38
Creation Date: 2022-09-19
Views: 849 		1663574400 849
Description: eCLIP experiments with ligation step allowing identification of miRNA-mRNA pairs and binding sites to around 60 nt resolution. Data generated in the laboratory of Todd Skaar.
Author: nrpowell
Session Name: miRNA_binding_sites_latest_Aug2022
Genome Assembly: hg38
Creation Date: 2022-09-01
Views: 1148 		1662019200 1148
Description: test
Author: ez176
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2022-09-01
Views: 799 		1662019200 799
Description: A session that isolates the 15 isoforms of SORBS1, a gene involved in insulin stimulation, and includes a custom track that isolates two of these isoforms. This session also includes the transcript expression GTEx track, which shows the frequencies of SORBS1 isoform expression in different types of tissue; Hence, one is able to see how each isoform of SORBS1 is expressed at different frequencies in each tissue type. The two isoforms highlighted within the custom track are great examples of isoform expression, as they are expressed in certain tissue types at vastly different rates.
Author: education
Session Name: hg19_SORBSct
Genome Assembly: hg19
Creation Date: 2022-08-30
Views: 1012 		1661846400 1012
Description: tracks for analysis of ERRg regulatory variants.
Author: agacita
Session Name: ERRg_basic
Genome Assembly: hg38
Creation Date: 2023-06-11
Views: 663 		1686470400 663
Description: The TBXT gene in its entirety. This gene is associated with the development of a tail and the way this gene is transcribed in hominoids results in their lack of an external tail. OMIM has two entries showing that variants on this gene are associated with spinal anomalies. For more information regarding this story, check out the Genome Browser education page: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_TBXTomim
Genome Assembly: hg19
Creation Date: 2022-08-30
Views: 1127 		1661846400 1127
Description: The squirrel monkey genome and the TBXT gene in its entirety. This gene is associated with the development of a tail and the way this gene is transcribed in hominoids results in their lack of an external tail. In monkeys, the inclusion of an exon in the mature transcript allows for formation of a tail. For more information regarding this story, check out the Genome Browser education page: https://genome.ucsc.edu/training/education
Author: education
Session Name: saiBol1_TBXT
Genome Assembly: saiBol1
Creation Date: 2022-08-24
Views: 977 		1661328000 977
Description: The TBXT gene in its entirety. This gene is associated with the development of a tail and the way this gene is transcribed in hominoids results in their lack of an external tail. Two Alu elements are highlighted; The yellow highlight (AluY) is unique to hominoids while the turquoise highlight (AluSx1) is found in all primates. The "Multiz Alignment" track illustrates which primates have the AluY element and which do not. For more information regarding this story, check out the Genome Browser education page: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_TBXTconservation
Genome Assembly: hg19
Creation Date: 2022-08-24
Views: 1002 		1661328000 1002
Description: The TBXT gene in its entirety. This gene is associated with the development of a tail and the way this gene is transcribed in hominoids results in their lack of an external tail. Two Alu elements are highlighted; The yellow highlight (AluY) is unique to hominoids while the turquoise highlight (AluSx1) is found in all primates. For more information regarding this story, check out the Genome Browser education page: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_TBXTalus
Genome Assembly: hg19
Creation Date: 2022-08-24
Views: 1264 		1661328000 1264
Description: The TBXT gene in its entirety. This gene is associated with the development of a tail and the way this gene is transcribed in hominoids results in their lack of an external tail. For more information regarding this story, visit the Genome Browser education page: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_TBXT
Genome Assembly: hg19
Creation Date: 2022-08-24
Views: 1089 		1661328000 1089
Description: BRCA1 gene region, showing CpG islands and DNA methylation. These regions influence gene expression. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_methylationAndIslands
Genome Assembly: hg19
Creation Date: 2022-08-19
Views: 1103 		1660896000 1103
Description: DNA methylation patterns with and without bi-sulfite treatment in BRCA1 region. These DNA modifications affect gene regulation. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_methylation
Genome Assembly: hg19
Creation Date: 2022-08-19
Views: 969 		1660896000 969
Description: Transcription factor binding sites and CpG island in BRCA1 region of human hg19 genome assembly. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_tfbs
Genome Assembly: hg19
Creation Date: 2022-08-19
Views: 1124 		1660896000 1124
Description: DMRs and DMPs in relation to H3K4me3 signals of Acute myeloid leukemia samples
Author: bacdao
Session Name: LAML
Genome Assembly: hg38
Creation Date: 2022-08-24
Views: 779 		1661328000 779
Description: POLN and HAUS3 share the first exon.
Author: Dongbo Ding
Session Name: POLN
Genome Assembly: hg19
Creation Date: 2022-08-06
Views: 842 		1659772800 842
Description: This session shows a portion of the ALDH2 gene, one of the two genes associated with alcohol intolerance in East Asian populations. The "GWAS" track is enabled and shows common nucleotide variants in the region and provides publications that further explore the consequences of a nucleotide change. Highlighted is rs671, which is the variant that causes “alcohol flush syndrome”; This condition is seen in approximately 30% to 50% of East Asian individuals. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_ALDH2gwas
Genome Assembly: hg19
Creation Date: 2022-07-21
Views: 1215 		1658390400 1215
Description: .....
Author: gperez2
Session Name: rn6_atp4
Genome Assembly: rn6
Creation Date: 2022-07-26
Views: 826 		1658822400 826
Description: Elys DamID in 16-18h Drosophila embryos.
Author: Shevelyov
Session Name: Elys_embryo DamID
Genome Assembly: dm3
Creation Date: 2022-12-14
Views: 768 		1671004800 768
Description: This session shows a portion of the ALDH2 gene, one of the two genes associated with alcohol intolerance in East Asian populations, in its entirety. The "Human Genome Diversity Project" (or "HGDP") track is enabled and marks variants that have different allele frequencies in individual populations. Clicking into a rsID provides specific population allele frequencies and a helpful visual aid. Highlighted is rs671, which is the variant that causes “alcohol flush syndrome”; This condition is seen in approximately 30% to 50% of East Asian individuals. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_ALDH2hgdp
Genome Assembly: hg19
Creation Date: 2022-07-21
Views: 995 		1658390400 995
Description: This session shows a portion of the ALDH2 gene, one of the two genes associated with alcohol intolerance in East Asian populations, in its entirety. The "Genome Aggregation Database" (or "gnomAD") track is enabled and marks variants that have different allele frequencies in individual populations. Clicking into a rsID provides specific population allele frequencies. Highlighted is rs671, which is the variant that causes “alcohol flush syndrome”; This condition is seen in approximately 30% to 50% of East Asian individuals. A click into the gnomAD track gives access to their population and other data. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_ALDH2gnomAD
Genome Assembly: hg19
Creation Date: 2022-07-21
Views: 1030 		1658390400 1030
Description: View of ARID1a gene with "CRISPR Targets" Data track enabled in pack mode. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education.
Author: education
Session Name: crispr_fig3
Genome Assembly: hg38
Creation Date: 2022-08-28
Views: 1042 		1661673600 1042
Description: FGFR2 on the “UCSC Genes” and “NCBI Genes” tracks. FGFR2 is read on the opposite, negative strand, hence the leftward facing intron arrows. Different splicing events produce different isoforms of the gene. Read more about splicing in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: fgfr2
Genome Assembly: hg19
Creation Date: 2022-02-24
Views: 1157 		1645689600 1157
Description: SNAPC1 gene shown with the first exon highlighted in orange. Find a story about three reading frames in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: 3frame_fig1
Genome Assembly: hg38
Creation Date: 2022-06-27
Views: 1544 		1656316800 1544
Description: Peak file 'MCF7_E2-ethl.hpeak.out' comparing E2 and ethl-treated (control) samples.
Author: NSP
Session Name: MCF7_E2-ethl_Peaks_hg18
Genome Assembly: hg18
Creation Date: 2022-06-28
Views: 934 		1656403200 934
Description: A close-up of the first exon in the SNAPC1 gene. In this session, we can see the three different frames and the different amino acid sequences each frame contains. Notice how the frame with the methionine is the only frame read for the gene, as it encodes for the start of the first exon of the gene. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: 3frame_fig2
Genome Assembly: hg38
Creation Date: 2022-06-27
Views: 1241 		1656316800 1241
Description: Regions of genome detected in biofluids with at least 1 unique reads from samples present in the exRNA Atlas (exrna-atlas.org).
Author: elaplant
Session Name: hg19_exRNA_coverage_1
Genome Assembly: hg19
Creation Date: 2022-06-17
Views: 982 		1655452800 982
Description: Regions of genome detected in biofluids with at least 5 unique reads from samples present in the exRNA Atlas (exrna-atlas.org).
Author: elaplant
Session Name: hg19_exRNA_coverage_5
Genome Assembly: hg19
Creation Date: 2022-06-17
Views: 1239 		1655452800 1239
Description: This session shows the proximity of the LCT gene and two variants within the intron of the nearby MCM6 gene that affect the activity of the LCT gene -- causing persistence of lactase activity into adulthood. People with these variants can digest milk as adults. Without at least one of them, lactose intolerance results. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_LCT_MCM6
Genome Assembly: hg19
Creation Date: 2022-06-03
Views: 1042 		1654243200 1042
Description: This session highlights a single nucleotide change (G to A) with pathogenic consequences found within FOXP2, a gene associated with human speech and language comprehension. FOXP2's association with speech was discovered through this single nucleotide change first witnessed in the "KE family"; A pedigree in which almost half of the members for the past three generations have developed a speech disorder called verbal dyspraxia. The OMIM track is enabled and has a marker representing the nucleotide change found in the KE family pedigree. This G to A allele change results in a codon that corresponds to a different amino acid, histidine instead of the correct amino arginine (p.R553H), and results in a faulty protein which, as seen in the KE family, causes verbal dyspraxia. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_FOXP2p.R553H
Genome Assembly: hg19
Creation Date: 2022-05-15
Views: 973 		1652601600 973
Description: METTL3 gene zoomed in on the 3rd exon. The amino acid numbering is from right to left, denoting this exon/gene is on the bottom strand. Note the arrow at the upper left indicating that the DNA sequence at the top of the display window runs right to left. (If you are unable to see the amino acid numbering when viewing a gene at this scale, click on the gray sidebar box next to the gene, click on “Configure”, check the box labeled, “Show codon numbering”, and click “Apply”.)
Author: education
Session Name: hg38_revStrandZoom2
Genome Assembly: hg38
Creation Date: 2022-06-01
Views: 1013 		1654070400 1013
Description: METTL3 gene view zoomed in on the 3rd exon. The amino acid numbering is from right to left, denoting this exon/gene is on the bottom strand. Note the arrow at the upper left indicating that the DNA sequence at the top of the display window runs left to right -- which is the reverse complement of the sequence encoding the amino acids. (If you are unable to see the amino acid numbering when viewing a gene at this scale, click on the gray sidebar box next to the gene, click on “Configure”, check the box labeled, “Show codon numbering”, and click “Apply”.) Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg38_revStrandZoom
Genome Assembly: hg38
Creation Date: 2022-05-31
Views: 1048 		1653984000 1048
Description: MYC gene with exons and introns. The direction of the small intron arrows can be seen to go from left to right in the MYC gene, denoting the direction of the gene and signifying that the 5’ end is to the left and 3’ to the right (“top” strand). Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg38_MYC
Genome Assembly: hg38
Creation Date: 2022-05-31
Views: 1262 		1653984000 1262
Description: There are two amino acid differences in the FOXP2 gene between the genomes of humans and other primates that have been of interest lately. These amino acid changes are thought to be connected to why humans are capable of speech while chimpanzees and other apes are not. This session shows one of these amino acid differences using the Multiz Alignment track; Humans possess a serine (S) in the highlighted position while the other primates present on the track have an asparagine (N). Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_FOXP2fig4
Genome Assembly: hg19
Creation Date: 2022-05-29
Views: 942 		1653811200 942
Description: Editing for public
Author: QAtester
Session Name: hg38_highlight_v431_edit
Genome Assembly: hg38
Creation Date: 2022-05-26
Views: 964 		1653552000 964
Description: session
Author: QAtester3
Session Name: hg19_v431
Genome Assembly: hg19
Creation Date: 2022-05-24
Views: 945 		1653379200 945
Description: The PLP1 gene is shown with GTEx track, indicating the tissue specificity of gene expression. Note the high signal is brain tissues (yellow bars). The OMIM Allelic Variants track is expanded to full display mode, showing the phenotypes of variants in different locations in the gene. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_pelizaeus
Genome Assembly: hg19
Creation Date: 2022-05-15
Views: 1078 		1652601600 1078
Description: PLP1 gene and OMIM Allelic Variants track. Different variants result in different disease states (mouseover the OMIM Variants). Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_PLP1
Genome Assembly: hg19
Creation Date: 2022-05-15
Views: 1045 		1652601600 1045
Description: Highly conserved region in GRK4 gene. High PhyloP score for first and second nucleotides of codons reflects amino acid conservation through evolutionary time. Third base varies (wobble) because these amino acids have multiple codons -- the third base can be anything is free to diverge through time. PFAM track shows that this is a functionally significant region (protein kinase). Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_wobble2
Genome Assembly: hg19
Creation Date: 2022-05-12
Views: 1088 		1652342400 1088
Description: ChIP-seq, ATAC-seq, and RNA-seq count data from sorted porcine myeloid cells in duplicate.
Author: rcorbett
Session Name: susScr11.1_Myeloid_ChIP_ATAC
Genome Assembly: susScr11
Creation Date: 2022-05-06
Views: 979 		1651824000 979
Description: Quiz 1.
Author: jschifflin
Session Name: hg19 RHO
Genome Assembly: hg19
Creation Date: 2023-09-05
Views: 581 		1693900800 581
Description: view of gene Rpl14 showing alternative splicing
Author: richardmott
Session Name: rn4.Rpl14
Genome Assembly: rn4
Creation Date: 2023-07-25
Views: 680 		1690272000 680
Description: view of gene Slc39a12 showing alternative splicing
Author: richardmott
Session Name: rn4.Slc39a12
Genome Assembly: rn4
Creation Date: 2023-07-25
Views: 613 		1690272000 613
Description:
Author: nannanzhao
Session Name: terc-ko
Genome Assembly: mm10
Creation Date: 2022-04-11
Views: 905 		1649664000 905
Description:
Author: davem
Session Name: midterm
Genome Assembly: hg38
Creation Date: 2022-04-06
Views: 922 		1649232000 922
Description: A session that isolates the 15 isoforms of SORBS1, a gene involved in insulin stimulation. This session also includes the two GTEx tracks, which illustrate frequencies of gene expression in different types of tissue.
Author: education
Session Name: hg19_SORBS1gtex
Genome Assembly: hg19
Creation Date: 2022-04-03
Views: 1025 		1648972800 1025
Description: A session that isolates the 15 isoforms of SORBS1, a gene involved in insulin stimulation. This session is utilized on the Education page in the "splice variants" document.
Author: education
Session Name: hg19_SORBS1
Genome Assembly: hg19
Creation Date: 2022-04-03
Views: 1169 		1648972800 1169
Description: There are two amino acid differences in the FOXP2 gene between the genomes of humans and other primates that have been of interest lately. These amino acid changes are thought to be connected to why humans are capable of speech while chimpanzees and other apes are not. This session shows one of these amino acid differences using the Multiz Alignment track; Humans possess an asparagine (N) in the highlighted position while the other primates present on the track have a threonine (T). Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_FOXP2fig3
Genome Assembly: hg19
Creation Date: 2022-05-15
Views: 947 		1652601600 947
Description: RHO hg19
Author: Chaffikm
Session Name: hg19 RHO
Genome Assembly: hg19
Creation Date: 2023-01-26
Views: 715 		1674720000 715
Description:
Author: ZC
Session Name: ATAC
Genome Assembly: hg38
Creation Date: 2022-03-25
Views: 1014 		1648195200 1014
Description:
Author: EsterCastillo
Session Name: Paneles_VHIO_bed
Genome Assembly: hg19
Creation Date: 2022-03-25
Views: 931 		1648195200 931
Description: Tracks from GEO GSE22104 Samples: GSM550303 Stat4WTTh1 GSM550304 Stat4KOTh1 GSM550305 H3K4me3WTTh1 GSM550306 H3K4me3 S4KOTh1 GSM550307 H3K27me3WTTh1 GSM550308 H3K27me3 S4KOTh1 content.txt files and bedgraph files
Author: twyss
Session Name: Chip_Stat4_Th1_Wei
Genome Assembly: mm9
Creation Date: 2024-12-13
Views: 294 		1734076800 294
Description: This session shows a short match on the UTR sequence for a gene, acugcugagcugggag. If you click below the black box, into the gene page for TGDS, you can then click an "RNA Structure" link. This will bring you to a section where you can then see for the 5' UTR a "Picture" link and see how this RNA fold structure may arrange.
Author: QAtester
Session Name: RNA_plot
Genome Assembly: hg38
Creation Date: 2022-05-03
Views: 1118 		1651564800 1118
Description: CHip
Author: xiaopei
Session Name: Chip_seq_B
Genome Assembly: hg38
Creation Date: 2024-07-01
Views: 359 		1719820800 359
Description: Review in this mailing list question, https://groups.google.com/a/soe.ucsc.edu/g/genome/c/y3evkDazY2o/m/0WjoQD63BQAJ, the "How to start from scratch to find tracks" and "How to view data in the region of interest and adjust display" sections and instead of using hg38 go to "GRCm38/mm10" and then use "TF" in the track search step. Set the "JASPAR Transcription Factors" track on mm10 to "pack" and then search "Mef2C" and select "Mef2c (ENSMUST00000198199.4) at chr13:83504034-83663343" from the search results, and then zoom out "1.5x" as well. Next click into the grey box for the "JASPAR Transcription Factors Track Settings" and click the "Schema" link on the far right. By clicking the Schema link you will see the fields for the "Primary Table: jaspar2022" and from this page you can use the Tools menu to arrive at the Table Browser, so this table will be automatically selected for you. Here click the "create" button next to "filter:" and for the "score is" field set it from "ignored" to ">" for greater than and put in a value such as 700 and then click submit. Then put in the "output filename:" field a name like "mm10Jaspar_Mef2c_score700.csv" and be sure that you click the button next to "csv (for excel)" and then click "get output" to download the results. Open the resulting file in Excel.
Author: brianlee
Session Name: Shiaoching
Genome Assembly: mm10
Creation Date: 2022-03-16
Views: 911 		1647417600 911
Description: Mm10 browser session associated with our manuscript "Integration of multimodal data in the developing tooth reveals candidate regulatory loci driving human odontogenic phenotypes", Frontiers in Dental Medicine, 2022
Author: emmawentworth
Session Name: mm10_all_18state
Genome Assembly: mm10
Creation Date: 2022-03-08
Views: 1759 		1646726400 1759
Description:
Author: hy123
Session Name: hg38 heart 1
Genome Assembly: hg38
Creation Date: 2022-03-07
Views: 913 		1646640000 913
Description:
Author: asaenz.13
Session Name: Genomics group 7 - final project
Genome Assembly: hg19
Creation Date: 2022-03-04
Views: 953 		1646380800 953
Description:
Author: YKehayova
Session Name: hg19 ATAC-seq 01.03.22
Genome Assembly: hg19
Creation Date: 2022-03-01
Views: 970 		1646121600 970
Description:
Author: aytyuh
Session Name: new
Genome Assembly: mm10
Creation Date: 2022-02-16
Views: 984 		1644998400 984
Description:
Author: JFormosa
Session Name: 2-15-22 Hwk6pt1
Genome Assembly: hg19
Creation Date: 2022-02-15
Views: 920 		1644912000 920
Description: This session shows a portion of the ALDH2 gene, one of the two genes associated with alcohol intolerance in East Asian populations. The "OMIM" track is enabled and shows common nucleotide variants in the region and provides information regarding the consequences of a nucleotide change. Highlighted is rs671, which is the variant that causes “alcohol flush syndrome”; This condition is seen in approximately 30% to 50% of East Asian individuals. Clicking into the OMIM track provides access to details hosted there. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_ALDH2omim
Genome Assembly: hg19
Creation Date: 2022-07-21
Views: 952 		1658390400 952
Description: This session shows the ALDH2 gene, one of the two genes associated with alcohol intolerance in East Asian populations, in its entirety. The "dbSNP 150" track is enabled and shows common nucleotide variants in the region. Highlighted is rs671, which is the variant that causes “alcohol flush syndrome”; This condition is seen in approximately 30% to 50% of East Asian individuals. A smaller rsID number corresponds to an earlier entry, meaning that rs671 is one of the earliest uploaded into NCBIs dbSnp database. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_ALDH2dbSNP150
Genome Assembly: hg19
Creation Date: 2022-07-21
Views: 1011 		1658390400 1011
Description:
Author: Chilliard
Session Name: hg19 - assignment 5
Genome Assembly: hg19
Creation Date: 2022-02-15
Views: 1244 		1644912000 1244
Description:
Author: JFormosa
Session Name: 2-14-22 Hwk 5
Genome Assembly: hg19
Creation Date: 2022-02-14
Views: 947 		1644825600 947
Description: Desiccation-induced inflammation and ocular surface disease is suppressed by terminal state MRC1 conjunctival macrophages.
Author: zhenzuo2
Session Name: MRC1_conjunctival_macrophages
Genome Assembly: mm10
Creation Date: 2024-04-23
Views: 488 		1713859200 488
Description:
Author: himtiffant
Session Name: p1 t1
Genome Assembly: mm10
Creation Date: 2022-02-09
Views: 1185 		1644393600 1185
Description:
Author: helenajara10
Session Name: mm10w/ Dock6
Genome Assembly: mm10
Creation Date: 2022-02-09
Views: 958 		1644393600 958
Description:
Author: aytyuh
Session Name: task 1
Genome Assembly: mm10
Creation Date: 2022-02-09
Views: 925 		1644393600 925
Description:
Author: helenajara10
Session Name: mm10w/interaction
Genome Assembly: mm10
Creation Date: 2022-02-09
Views: 909 		1644393600 909
Description:
Author: Jcotney
Session Name: TFAP2_Enhancer_KO_Session
Genome Assembly: hg38
Creation Date: 2022-02-08
Views: 1048 		1644307200 1048
Description:
Author: chunmei1991
Session Name: ChIPseq_peak_profile_Weilab
Genome Assembly: hg19
Creation Date: 2022-02-06
Views: 1096 		1644134400 1096
Description: Close view of the ARID1a gene with the "CRISPR Targets" data track enabled. Filter is set to 90 to show only the best sites. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: crispr_fig5
Genome Assembly: hg38
Creation Date: 2022-08-28
Views: 981 		1661673600 981
Description: This session isolates a nonsense single nucleotide variant (rs886040510), highlighted in turquoise, found on BRCA2 which is a gene associated with breast cancer. The "dbSNP" track has information regarding this variant. This variant is an A to T change and is known to have pathogenic consequences. The "ClinVar" track confirms rs886040510's pathogenicity with a red box and bead. Clicking onto either of these markings will navigate you to a details page that provides more information. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_BRCA2stopclinvar
Genome Assembly: hg19
Creation Date: 2022-02-03
Views: 937 		1643875200 937
Description: This session isolates a nonsense single nucleotide variant (rs886040510), highlighted in turquoise, found on BRCA2 which is a gene associated with breast cancer. The dbSNP track has information regarding this variant. This variant is an A to T change and is known to have pathogenic consequences. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_BRCA2stopgain
Genome Assembly: hg19
Creation Date: 2022-02-03
Views: 1182 		1643875200 1182
Description: This session shows a synonymous variant found on BRCA2, a gene associated with breast cancer. The nucleotide change does result in a changed amino acid. The variant in question is highlighted in turquoise. Two dbSNP tracks are enabled and provide more information about the variant. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_BRCA2synon
Genome Assembly: hg19
Creation Date: 2022-02-03
Views: 987 		1643875200 987
Description: This session shows a frameshift variant (highlighted in turquoise) on BRCA2, a gene associated with breast cancer. The variant is a deletion of two nucleotides, C and T. This deletion results in a change in the reading frame. Two dbSNP tracks are enabled and provide more information on the variant. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_BRCA2frameshift
Genome Assembly: hg19
Creation Date: 2022-02-03
Views: 978 		1643875200 978
Description: This session shows a frameshift variant (highlighted in turquoise, but looks pale green under the yellow highlight) on BRCA2, a gene associated with breast cancer. The variant is a deletion of two nucleotides, C and T. This deletion results in a change in the reading frame. The pale yellow highlight shows this change, AGT being the new codon after the C and T nucleotides (pale green) are deleted. This changes the reading frame from the second frame to the first frame shown on the Base Position track, which is set to full in order to visualize three potential reading frames. The red highlight marks the stop codon of this new reading frame. Therefore, this frameshift variant results in a premature stop codon. The dbSNP track is enabled and provides more information on the variant. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_BRCA2frames
Genome Assembly: hg19
Creation Date: 2022-02-03
Views: 973 		1643875200 973
Description: This session shows a missense variant, highlighted in turquoise, found on BRCA2. This single nucleotide variant (SNV) changes the resulting amino acid; The original codon "CAT" codes for histidine while an individual with the variant in question would possess either the codon "CAA" or "CAG", coding for glutamine. This means the resulting polypeptide chain would be impacted. However, ClinVar's data does not label this variant as pathogenic. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_BRCA2missense
Genome Assembly: hg19
Creation Date: 2022-02-03
Views: 999 		1643875200 999
Description: This session shows a portion of BRCA2 (exon 11), a gene associated with breast cancer. Two dbSNP tracks are enabled and mark known variants in the region displayed. Red boxes represent variants that disrupt effective protein production (missense), while green boxes indicate that the variant does not change the resulting amino acid (synonymous). Some of these missense variants have pathogenic consequences, causing breast cancer. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_BRCA2variants
Genome Assembly: hg19
Creation Date: 2022-02-03
Views: 1178 		1643875200 1178
Description: The genes HBB and HBD are both expressed in red blood cells, but HBB is also expressed in many other tissues, whereas HBD is expressed in red cells almost exclusively.
Author: helenajara10
Session Name: hg19_hemoglobin
Genome Assembly: hg19
Creation Date: 2022-02-03
Views: 1390 		1643875200 1390
Description:
Author: Kaushik
Session Name: PHOX2B
Genome Assembly: hg18
Creation Date: 2022-02-05
Views: 1012 		1644048000 1012
Description:
Author: pwjeffries
Session Name: hg38Covert
Genome Assembly: hg38
Creation Date: 2022-02-02
Views: 966 		1643788800 966
Description:
Author: katerynamarku
Session Name: Fall19 Yeast test (KM)
Genome Assembly: sacCer3
Creation Date: 2022-01-31
Views: 996 		1643616000 996
Description:
Author: pham4tt
Session Name: Spring20 Yeat Test TM,KM,EL
Genome Assembly: sacCer3
Creation Date: 2022-01-31
Views: 901 		1643616000 901
Description:
Author: tomgo
Session Name: mm10- enhancers
Genome Assembly: mm10
Creation Date: 2022-01-31
Views: 932 		1643616000 932
Description:
Author: jos200a
Session Name: Fall 2022 Yeast Test JEAA
Genome Assembly: sacCer3
Creation Date: 2022-01-30
Views: 919 		1643529600 919
Description:
Author: Cliffford081915
Session Name: Spring2022 Yeast Test(JDC)
Genome Assembly: sacCer3
Creation Date: 2022-01-30
Views: 924 		1643529600 924
Description:
Author: garberla
Session Name: CGEMS yeast LG test
Genome Assembly: sacCer3
Creation Date: 2022-01-26
Views: 1043 		1643184000 1043
Description:
Author: ajaycox
Session Name: CGEMS yeast (AJ) test
Genome Assembly: sacCer3
Creation Date: 2022-01-26
Views: 964 		1643184000 964
Description:
Author: espinokb
Session Name: CGEMS yeast KE test
Genome Assembly: sacCer3
Creation Date: 2022-01-26
Views: 963 		1643184000 963
Description:
Author: CherryLab
Session Name: Nuclear_EyeBrowser_TrackHub
Genome Assembly: hg38
Creation Date: 2021-11-01
Views: 1813 		1635753600 1813
Description:
Author: aytyuh
Session Name: mm10
Genome Assembly: mm10
Creation Date: 2022-02-09
Views: 1171 		1644393600 1171
Description:
Author: YKehayova
Session Name: hg19 SBNO1 project
Genome Assembly: hg19
Creation Date: 2022-01-20
Views: 998 		1642665600 998
Description:
Author: Pey.davoodi
Session Name: Optional
Genome Assembly: hg19
Creation Date: 2022-02-07
Views: 910 		1644220800 910
Description:
Author: Pey.davoodi
Session Name: 4-genes-workshop
Genome Assembly: hg19
Creation Date: 2022-02-07
Views: 949 		1644220800 949
Description:
Author: YKehayova
Session Name: hg19 ATAC peaks COLGALT2 promoter
Genome Assembly: hg19
Creation Date: 2022-01-19
Views: 1052 		1642579200 1052
Description: ChIP, ATAC, and RNA-seq counts for sorted porcine myeloid cells in duplicate, along with H3K27ac and H3K4me3 data from other cell types for comparison.
Author: rcorbett
Session Name: susScr11_Myeloid_ChIP_ATAC_comparison
Genome Assembly: susScr11
Creation Date: 2022-05-06
Views: 1003 		1651824000 1003
Description: CAG repeats in the HTT gene. Expansion of the CAG repeats leads to Huntington's disease. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: htt_main
Genome Assembly: hg19
Creation Date: 2022-01-13
Views: 1257 		1642060800 1257
Description: A session highlighting two single-nucleotide variants found in introns 9 and 13 of the MCM6 gene, located upstream from the LCT gene, that impact whether or not an individual is lactase persistent as an adult. Both the OMIM and GWAS tracks have marked these variants as phenotypically relevant to the appearance of lactase persistence. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_LCT
Genome Assembly: hg19
Creation Date: 2021-12-25
Views: 1706 		1640419200 1706
Description:
Author: dxliucmu
Session Name: hg38_ ChIP with H3K4me1 in HC vs SCZ (one pair))
Genome Assembly: hg38
Creation Date: 2022-01-09
Views: 927 		1641715200 927
Description:
Author: JFormosa
Session Name: Hwk6Pt1
Genome Assembly: hg19
Creation Date: 2022-02-22
Views: 910 		1645516800 910
Description: UCLA 2022 workshop -- custom tracks Alus from dbRIP not in rmsk; CAT gene with two names, some SNPs from 151 missense and intron
Author: Example
Session Name: hg19_snp_CAT_Alus
Genome Assembly: hg19
Creation Date: 2022-01-20
Views: 976 		1642665600 976
Description:
Author: ani_davis
Session Name: Spring22 Yeast Test AND
Genome Assembly: sacCer3
Creation Date: 2022-01-31
Views: 958 		1643616000 958
Description: IPMK intron Author: Mustafi P Session Name: ATAC-seqPC4 Genome Assembly: hg19
Author: pallabidgp123
Session Name: ATAC-seq6
Genome Assembly: hg19
Creation Date: 2021-12-25
Views: 1035 		1640419200 1035
Description: ATG5 intron Author: Mustafi P Session Name: ATAC-seqPC4 Genome Assembly: hg19
Author: pallabidgp123
Session Name: ATAC-seq4
Genome Assembly: hg19
Creation Date: 2021-12-23
Views: 1059 		1640246400 1059
Description: MAP3K7 intron Author: Mustafi P Session Name: ATAC-seq2 Genome Assembly: hg19
Author: pallabidgp123
Session Name: ATAC-seq2
Genome Assembly: hg19
Creation Date: 2021-12-23
Views: 1305 		1640246400 1305
Description: UVRAG promoter-TSS Author: Mustafi P Session Name: ATAC-seqPC4 Genome Assembly: hg19
Author: pallabidgp123
Session Name: ATAC-seq1
Genome Assembly: hg19
Creation Date: 2021-12-23
Views: 1121 		1640246400 1121
Description: IPMK intron Author: Mustafi P Session Name: ATAC-seqPC4 Genome Assembly: hg19
Author: pallabidgp123
Session Name: ATAC-seq PC4
Genome Assembly: hg19
Creation Date: 2021-12-23
Views: 982 		1640246400 982
Description: IPMK intron Author: Mustafi P Session Name: ATAC-seq5 Genome Assembly: hg19
Author: pallabidgp123
Session Name: ATAC-seq5
Genome Assembly: hg19
Creation Date: 2021-12-23
Views: 1130 		1640246400 1130
Description: YEATS2 intron TSS Author: Mustafi P Session Name: ATAC-seq3 Genome Assembly: hg19
Author: pallabidgp123
Session Name: ATAC-seq3
Genome Assembly: hg19
Creation Date: 2021-12-23
Views: 1051 		1640246400 1051
Description: Close-up view if transition zone between a coding and a non-coding region of the virus. Note the High conservation in the PhyloP track in the protein-coding region. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: ebolav_pconserv
Genome Assembly: eboVir3
Creation Date: 2021-12-22
Views: 881 		1640160000 881
Description: Ebola virus VP24 gene with PhyloP track showing high conservation in the protein-coding region among 160+ isolates. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: ebolav_phylop
Genome Assembly: eboVir3
Creation Date: 2021-12-22
Views: 1093 		1640160000 1093
Description: Ebola virus genome showing vp24 gene region. The PhyloP track shows that the 100+ strains of ebola and Marburg have conservation in the protein-coding region of the gene. Pink color indicates a positive value above the display level in the track. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: ebolav_vp24
Genome Assembly: eboVir3
Creation Date: 2021-12-22
Views: 952 		1640160000 952
Description: Zoomed-in view of ebolavirus L protein showing serine codon in the reference that is different in many islolates distantly related to it (lower part of figure). Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: ebolav_codon
Genome Assembly: eboVir3
Creation Date: 2021-12-22
Views: 930 		1640160000 930
Description: Full genome of the ebola virus showing a blat alignment of the Marburg virus. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: ebolav_blatsearch
Genome Assembly: eboVir3
Creation Date: 2021-12-22
Views: 955 		1640160000 955
Description: Full genome of ebola virus showing proteins in the top track and conservation among several outbreaks in the lower tracks. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: ebolav_mainsession
Genome Assembly: eboVir3
Creation Date: 2021-12-22
Views: 980 		1640160000 980
Description: Visualization of the BRCA1 Gene, CpG islands and DNA methylations in different cell lines using the bisulfite Seq and Methyl 450k method.
Author: art_03m
Session Name: hg19: Methylation & CpG islands in BRCA1 gene
Genome Assembly: hg19
Creation Date: 2021-12-18
Views: 669 		1639814400 669
Description:
Author: adelaidetovar
Session Name: apoa2
Genome Assembly: hg38
Creation Date: 2021-12-13
Views: 927 		1639382400 927
Description:
Author: Schne2lk
Session Name: hg38 NRL multiomics
Genome Assembly: hg38
Creation Date: 2021-12-07
Views: 956 		1638864000 956
Description:
Author: marielgr
Session Name: ACSS2_ChIPseq
Genome Assembly: mm39
Creation Date: 2021-12-17
Views: 925 		1639728000 925
Description: Aging MapR data in photoreceptor neurons. Loaded bigwig track correspond to the averaged signal for each aging time point generated from three independent biological replicates
Author: juanjaureguilozano
Session Name: dm6_agingMapR
Genome Assembly: dm6
Creation Date: 2021-12-01
Views: 9667 		1638345600 9667
Description: A pipeline for predicting cardiac gene network components using cis-regulatory elements (CREs) Manuscript: Hieu T. Nim*, Louis Dang*, Harshini Thiyagarajah*, Daniel Bakopoulos, Michael See, Natalie Charitakis, Tennille Sibbritt, Michael P. Eichenlaub, Stuart K. Archer, Nicolas Fossat, Richard E. Burke, Patrick P. L. Tam, Coral G. Warr‡, Travis K. Johnson‡#, Mirana Ramialison‡#. "Predicting genes essential for heart development irrespective of their spatial expression pattern". Genome Biology (in press). (*: co-first authors; ‡: co-senior authors; #: corresponding authors)
Author: nimt0001
Session Name: CardiacNetworkComponentPredictor
Genome Assembly: mm9
Creation Date: 2021-11-30
Views: 1257 		1638259200 1257
Description:
Author: latimeaa
Session Name: Hg38 HISAT2 Retina tracks
Genome Assembly: hg38
Creation Date: 2021-11-30
Views: 971 		1638259200 971
Description:
Author: Eldar
Session Name: SNV
Genome Assembly: hg38
Creation Date: 2021-02-16
Views: 1349 		1613462400 1349
Description:
Author: Eldar
Session Name: CNV
Genome Assembly: hg38
Creation Date: 2021-02-25
Views: 1677 		1614240000 1677
Description:
Author: aigul
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2021-11-18
Views: 1047 		1637222400 1047
Description:
Author: Wen-Cheng
Session Name: Liver_APOA5p
Genome Assembly: hg19
Creation Date: 2020-11-04
Views: 1662 		1604476800 1662
Description:
Author: zunpengliu66
Session Name: WT H3K9me3 ChIP-seq
Genome Assembly: hg38
Creation Date: 2021-11-11
Views: 926 		1636617600 926
Description:
Author: randa2jl
Session Name: Human retina multiomics
Genome Assembly: hg38
Creation Date: 2021-11-16
Views: 948 		1637049600 948
Description:
Author: young_researcher
Session Name: hg19_intersection
Genome Assembly: hg19
Creation Date: 2021-11-07
Views: 1268 		1636272000 1268
Description:
Author: young_researcher
Session Name: hg19_H3F3A
Genome Assembly: hg19
Creation Date: 2021-11-07
Views: 1107 		1636272000 1107
Description:
Author: vladislav
Session Name: intersect_with_DeepZ
Genome Assembly: hg19
Creation Date: 2021-11-06
Views: 967 		1636185600 967
Description:
Author: vladislav
Session Name: H3F3A.merge
Genome Assembly: hg19
Creation Date: 2021-11-06
Views: 1045 		1636185600 1045
Description:
Author: vladislav
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2021-11-06
Views: 1109 		1636185600 1109
Description:
Author: megallegos
Session Name: Independent Project Link
Genome Assembly: hg19
Creation Date: 2021-11-05
Views: 1354 		1636099200 1354
Description:
Author: randa2jl
Session Name: PDE6A
Genome Assembly: mm9
Creation Date: 2021-11-04
Views: 1014 		1636012800 1014
Description:
Author: Schne2lk
Session Name: mm9 RCVRN
Genome Assembly: mm9
Creation Date: 2021-11-04
Views: 997 		1636012800 997
Description:
Author: Schne2lk
Session Name: mm9 HTT
Genome Assembly: mm9
Creation Date: 2021-11-04
Views: 1474 		1636012800 1474
Description:
Author: Schne2lk
Session Name: mm9 thrb
Genome Assembly: mm9
Creation Date: 2021-11-04
Views: 986 		1636012800 986
Description:
Author: randa2jl
Session Name: wt/nrl CBRs
Genome Assembly: mm9
Creation Date: 2021-11-04
Views: 1358 		1636012800 1358
Description:
Author: laarne
Session Name: CHIP SEQ ACTUAL SESSION CBR
Genome Assembly: mm9
Creation Date: 2021-11-04
Views: 997 		1636012800 997
Description:
Author: Schne2lk
Session Name: mm9 PDE6A
Genome Assembly: mm9
Creation Date: 2021-11-04
Views: 1020 		1636012800 1020
Description:
Author: adityabhagwate
Session Name: bw_upload
Genome Assembly: hg19
Creation Date: 2021-11-03
Views: 1044 		1635926400 1044
Description:
Author: ashleywilkins
Session Name: DSP
Genome Assembly: hg19
Creation Date: 2021-11-02
Views: 1507 		1635840000 1507
Description:
Author: sweatbr
Session Name: MYBPC1
Genome Assembly: hg19
Creation Date: 2021-11-02
Views: 1031 		1635840000 1031
Description:
Author: sweatbr
Session Name: DSP
Genome Assembly: hg19
Creation Date: 2021-11-02
Views: 1248 		1635840000 1248
Description:
Author: randa2jl
Session Name: MYBPC1
Genome Assembly: hg19
Creation Date: 2021-11-02
Views: 1504 		1635840000 1504
Description:
Author: ashleywilkins
Session Name: Cardiomyopathy
Genome Assembly: hg19
Creation Date: 2021-11-02
Views: 1106 		1635840000 1106
Description:
Author: Schne2lk
Session Name: hg19 DSP
Genome Assembly: hg19
Creation Date: 2021-11-02
Views: 967 		1635840000 967
Description:
Author: randa2jl
Session Name: hg19-RHO custom track
Genome Assembly: hg19
Creation Date: 2021-11-02
Views: 934 		1635840000 934
Description:
Author: Schne2lk
Session Name: hg19 MYBPC1
Genome Assembly: hg19
Creation Date: 2021-11-02
Views: 998 		1635840000 998
Description:
Author: sweatbr
Session Name: RIDLEY
Genome Assembly: hg38
Creation Date: 2021-11-04
Views: 1031 		1636012800 1031
Description:
Author: randa2jl
Session Name: Fall21 HTT gene Huntingtons
Genome Assembly: hg38
Creation Date: 2021-10-19
Views: 1151 		1634630400 1151
Description:
Author: Schne2lk
Session Name: hg38 HTT
Genome Assembly: hg38
Creation Date: 2021-10-19
Views: 993 		1634630400 993
Description:
Author: whaleycn
Session Name: HTT
Genome Assembly: hg38
Creation Date: 2021-10-19
Views: 1012 		1634630400 1012
Description:
Author: JuliaLaz
Session Name: HTT
Genome Assembly: hg38
Creation Date: 2021-10-18
Views: 1064 		1634544000 1064
Description:
Author: ashleywilkins
Session Name: hg38 HTT GENE
Genome Assembly: hg38
Creation Date: 2021-10-17
Views: 1256 		1634457600 1256
Description:
Author: CherryLab
Session Name: VISIONS_TrackHub
Genome Assembly: hg38
Creation Date: 2021-10-15
Views: 1206 		1634284800 1206
Description: This session includes two custom tracks on chromosome 22, spanning the region 20100000-20140000. The first track, named 'spacer', displays blue ticks every 10,000 bases. The second track, named 'even', shows red ticks every 100 bases, skipping 100 bases between each tick. The 'even' track also includes labels for the first three ticks: 'first', 'second', and 'third'. These custom tracks demonstrate the use of BED format for visualizing specific genomic intervals and annotations.
Author: Parth Doshi
Session Name: Custom Track Assignment
Genome Assembly: hg38
Creation Date: 2024-11-06
Views: 244 		1730880000 244
Description:
Author: yoni.arndt
Session Name: ex.1 RAC1
Genome Assembly: hg38
Creation Date: 2021-10-15
Views: 1035 		1634284800 1035
Description:
Author: randa2jl
Session Name: Fall21 HGD gene
Genome Assembly: hg38
Creation Date: 2021-10-14
Views: 988 		1634198400 988
Description:
Author: sweatbr
Session Name: chr3chimp
Genome Assembly: hg38
Creation Date: 2021-10-12
Views: 1103 		1634025600 1103
Description:
Author: randa2jl
Session Name: Fall21 HumanChr2 JennaRandall
Genome Assembly: hg38
Creation Date: 2021-10-12
Views: 1234 		1634025600 1234
Description:
Author: JFormosa
Session Name: Hwk6Pt4b
Genome Assembly: hg19
Creation Date: 2022-02-22
Views: 896 		1645516800 896
Description:
Author: JFormosa
Session Name: Hwk6Pt4a
Genome Assembly: hg19
Creation Date: 2022-02-22
Views: 924 		1645516800 924
Description:
Author: mjliddi16
Session Name: hg19_assignment6
Genome Assembly: hg19
Creation Date: 2022-02-22
Views: 1301 		1645516800 1301
Description: BINF6310
Author: Rahulprasad Selvaraj
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2023-11-08
Views: 499 		1699430400 499
Description:
Author: tboisjol
Session Name: TB-98358724-MEDG580-UBC-2020
Genome Assembly: hg38
Creation Date: 2021-10-08
Views: 1226 		1633680000 1226
Description:
Author: millerh1@livemail.uthscsa.edu
Session Name: RLBase
Genome Assembly: hg38
Creation Date: 2021-10-06
Views: 2679 		1633507200 2679
Description:
Author: millerh1@livemail.uthscsa.edu
Session Name: RLBase_slow
Genome Assembly: hg38
Creation Date: 2021-10-05
Views: 1168 		1633420800 1168
Description:
Author: kkaczor
Session Name: tamer_hiv_atac
Genome Assembly: hg38
Creation Date: 2021-09-30
Views: 1281 		1632988800 1281
Description:
Author: kkaczor
Session Name: tamer_hiv_rna
Genome Assembly: hg38
Creation Date: 2021-09-29
Views: 1239 		1632902400 1239
Description:
Author: laarne
Session Name: hg38 HTT gene
Genome Assembly: hg38
Creation Date: 2021-10-19
Views: 1058 		1634630400 1058
Description:
Author: areynolds
Session Name: hg38 HBB-LCR
Genome Assembly: hg38
Creation Date: 2021-09-20
Views: 1190 		1632124800 1190
Description:
Author: jschlachetzki
Session Name: 20210917_4DBSM_Schlachetzki
Genome Assembly: hg19
Creation Date: 2021-09-17
Views: 1107 		1631865600 1107
Description:
Author: layla13
Session Name: TSA2R38 Group #4
Genome Assembly: hg19
Creation Date: 2021-09-16
Views: 936 		1631779200 936
Description:
Author: Thijs
Session Name: Wnt_human_NGS_20210914_V2
Genome Assembly: hg38
Creation Date: 2021-09-14
Views: 1228 		1631606400 1228
Description:
Author: mallorycunningham
Session Name: TASR38 group3
Genome Assembly: hg19
Creation Date: 2021-09-12
Views: 1179 		1631433600 1179
Description:
Author: noycohen
Session Name: HepG2 and K562 Methylation
Genome Assembly: hg38
Creation Date: 2021-09-12
Views: 1466 		1631433600 1466
Description:
Author: msadams
Session Name: A549
Genome Assembly: hg38
Creation Date: 2021-09-28
Views: 989 		1632816000 989
Description:
Author: xuxing
Session Name: multi-Paired-seq
Genome Assembly: hg38
Creation Date: 2021-10-31
Views: 1004 		1635667200 1004
Description:
Author: jessicagarth
Session Name: TAS2R38 group4
Genome Assembly: hg19
Creation Date: 2021-09-08
Views: 1166 		1631088000 1166
Description:
Author: hayes22
Session Name: Fall21 Yeast Test JEH
Genome Assembly: sacCer3
Creation Date: 2021-09-08
Views: 1169 		1631088000 1169
Description:
Author: SamanthaBusch
Session Name: Fall21 Yeast test SIB
Genome Assembly: sacCer3
Creation Date: 2021-09-07
Views: 1229 		1631001600 1229
Description:
Author: Siddeldj
Session Name: Fall19 yeast test DJS
Genome Assembly: sacCer3
Creation Date: 2021-09-07
Views: 1186 		1631001600 1186
Description:
Author: Albert Cheng
Session Name: hg38_ZFP18_1
Genome Assembly: hg38
Creation Date: 2021-09-07
Views: 1228 		1631001600 1228
Description:
Author: Albert Cheng
Session Name: hg38_Cas9_1_0_0_0
Genome Assembly: hg38
Creation Date: 2021-09-07
Views: 1126 		1631001600 1126
Description:
Author: Albert Cheng
Session Name: hg38_ZFP18_1_0
Genome Assembly: hg38
Creation Date: 2021-09-07
Views: 1216 		1631001600 1216
Description:
Author: Albert Cheng
Session Name: hg38_ZFP18_1_0_0
Genome Assembly: hg38
Creation Date: 2021-09-07
Views: 1484 		1631001600 1484
Description:
Author: JuliaLaz
Session Name: hg19_hemoglobin
Genome Assembly: hg19
Creation Date: 2021-09-07
Views: 1334 		1631001600 1334
Description:
Author: AbigailLambert
Session Name: Fall19 Yeast test AML
Genome Assembly: sacCer3
Creation Date: 2021-09-12
Views: 1099 		1631433600 1099
Description:
Author: layla13
Session Name: Fall21 Yeast test LA
Genome Assembly: sacCer3
Creation Date: 2021-09-05
Views: 1161 		1630828800 1161
Description:
Author: gucascau
Session Name: H3-3-2
Genome Assembly: mm10
Creation Date: 2021-09-03
Views: 1172 		1630656000 1172
Description:
Author: mallorycunningham
Session Name: Fall21 Yeast Test MC
Genome Assembly: sacCer3
Creation Date: 2021-09-03
Views: 1162 		1630656000 1162
Description:
Author: jessicagarth
Session Name: CGEMS yeast JMG test
Genome Assembly: sacCer3
Creation Date: 2021-09-02
Views: 1173 		1630569600 1173
Description:
Author: JuliaLaz
Session Name: Fall21 Worm test group#4
Genome Assembly: ce11
Creation Date: 2021-09-02
Views: 913 		1630569600 913
Description:
Author: latimeaa
Session Name: CGEMS Worm AAL test
Genome Assembly: ce11
Creation Date: 2021-09-02
Views: 1103 		1630569600 1103
Description:
Author: latimeaa
Session Name: Fall21 Worm test group#4
Genome Assembly: ce11
Creation Date: 2021-09-02
Views: 979 		1630569600 979
Description:
Author: aazari99
Session Name: CGEMS Worm AA Test
Genome Assembly: ce11
Creation Date: 2021-09-02
Views: 1214 		1630569600 1214
Description:
Author: aazari99
Session Name: Fall21 Worm test group#3
Genome Assembly: ce11
Creation Date: 2021-09-02
Views: 934 		1630569600 934
Description:
Author: Schne2lk
Session Name: Fall21 Worm test group#3
Genome Assembly: ce11
Creation Date: 2021-09-02
Views: 908 		1630569600 908
Description:
Author: laarne
Session Name: CGEMS worm LAN test
Genome Assembly: ce11
Creation Date: 2021-09-02
Views: 1181 		1630569600 1181
Description:
Author: whaleycn
Session Name: Fall21 Mouse Test Group(6)
Genome Assembly: mm9
Creation Date: 2021-09-02
Views: 1122 		1630569600 1122
Description:
Author: ashleywilkins
Session Name: Fall21 Worm test group #4
Genome Assembly: ce11
Creation Date: 2021-09-02
Views: 1009 		1630569600 1009
Description:
Author: randa2jl
Session Name: Fall21 Yeast Test Group 1
Genome Assembly: sacCer3
Creation Date: 2021-09-02
Views: 1102 		1630569600 1102
Description:
Author: asinerbc
Session Name: FAll21 Yeast test group 2
Genome Assembly: sacCer3
Creation Date: 2021-09-02
Views: 1136 		1630569600 1136
Description:
Author: AHRImmunity
Session Name: stockingerg_ATACSEQ
Genome Assembly: mm10
Creation Date: 2021-09-01
Views: 1292 		1630483200 1292
Description:
Author: AHRImmunity
Session Name: stockingerg_CHIPSEQ
Genome Assembly: mm10
Creation Date: 2021-09-01
Views: 1342 		1630483200 1342
Description:
Author: Eldar
Session Name: gene level
Genome Assembly: hg38
Creation Date: 2021-08-27
Views: 1182 		1630051200 1182
Description:
Author: aytyuh
Session Name: newnew
Genome Assembly: mm10
Creation Date: 2022-02-16
Views: 923 		1644998400 923
Description:
Author: ssdhar
Session Name: hg19 Pim1 Bc
Genome Assembly: hg19
Creation Date: 2021-08-25
Views: 1282 		1629878400 1282
Description:
Author: zxtzhangqian
Session Name: Lamprey_WGBS
Genome Assembly: petMar3
Creation Date: 2021-08-25
Views: 1209 		1629878400 1209
Description:
Author: schmi4am
Session Name: Fall19 Yeast test AMS
Genome Assembly: sacCer3
Creation Date: 2021-09-05
Views: 1169 		1630828800 1169
Description:
Author: ssdhar
Session Name: hg19 mmp11 bc
Genome Assembly: hg19
Creation Date: 2021-08-17
Views: 1234 		1629187200 1234
Description:
Author: ssdhar
Session Name: hg19 new H3k27 ac six1
Genome Assembly: hg19
Creation Date: 2021-08-17
Views: 1213 		1629187200 1213
Description:
Author: lyj
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2021-08-15
Views: 1166 		1629014400 1166
Description:
Author: lyj
Session Name: mm10
Genome Assembly: mm10
Creation Date: 2021-08-15
Views: 1482 		1629014400 1482
Description: H3K27ac ChIP-seq count data from A375 melanoma in response to medium-chain fatty acid (octanoate) administration.
Author: thuang316
Session Name: H3K27ac_ChIP_seq_octanoate
Genome Assembly: hg38
Creation Date: 2021-08-15
Views: 995 		1629014400 995
Description: ReMap 2022: A database of Human, Mouse, Drosophila and Arabidopsis regulatory regions from an integrative analysis of DNA-binding sequencing experiments Go to <a href="http://remap2022.univ-amu.fr">ReMap2022</a> for more info.
Author: Benoit Ballester
Session Name: US_hg38_ReMap2022
Genome Assembly: hg38
Creation Date: 2021-08-11
Views: 4938 		1628668800 4938
Description: ReMap 2022: A database of Human, Mouse, Drosophila and Arabidopsis regulatory regions from an integrative analysis of DNA-binding sequencing experiments Go to <a href="http://remap2022.univ-amu.fr">ReMap2022</a> for more info.
Author: Benoit Ballester
Session Name: US_mm10_ReMap2022
Genome Assembly: mm10
Creation Date: 2021-08-11
Views: 2784 		1628668800 2784
Description: ReMap 2022: A database of Human, Mouse, Drosophila and Arabidopsis regulatory regions from an integrative analysis of DNA-binding sequencing experiments Go to <a href="http://remap2022.univ-amu.fr">ReMap2022</a> for more info.
Author: Benoit Ballester
Session Name: US_dm6_ReMap2022
Genome Assembly: dm6
Creation Date: 2021-08-11
Views: 1669 		1628668800 1669
Description: ReMap 2022: A database of Human, Mouse, Drosophila and Arabidopsis regulatory regions from an integrative analysis of DNA-binding sequencing experiments Go to <a href="http://remap2022.univ-amu.fr">ReMap2022</a> for more info.
Author: Benoit Ballester
Session Name: US_araTha1_ReMap2022
Genome Assembly: hub_2961057_araTha1
Creation Date: 2021-08-11
Views: 2633 		1628668800 2633
Description: This session uses Times font.
Author: brianlee
Session Name: Times_Font
Genome Assembly: hg38
Creation Date: 2021-08-10
Views: 3700 		1628582400 3700
Description: A Public Session using the Avant Guard Font.
Author: brianlee
Session Name: AvantG_Font
Genome Assembly: hg19
Creation Date: 2021-08-10
Views: 2703 		1628582400 2703
Description: 4931406C07Rik Transcripts
Author: szaman2
Session Name: 4931406C07Rik
Genome Assembly: mm10
Creation Date: 2021-08-10
Views: 1145 		1628582400 1145
Description:
Author: jamesli
Session Name: RNA_ATAC_Cerebellum1
Genome Assembly: mm10
Creation Date: 2021-08-06
Views: 978 		1628236800 978
Description:
Author: gucascau
Session Name: mm10
Genome Assembly: mm10
Creation Date: 2021-08-05
Views: 1249 		1628150400 1249
Description: Sessions shows part of spike protein on SARS-CoV-2 genome. One track shows the reference amino acids for the spike protein. A custom track at the top shows the location of two amino acids that are substituted by prolines to hold the protein in the pre-fusion conformation. A track near the bottom shows the Moderna and Pfizer/BioNtech vaccines with the two prolines substituted for lysine and valine of the reference. The last rack shows current variants of concern (VoC). Reconfigure the vaccine track to see the "different RNA bases" by clicking the gray button to the left of track.
Author: Example
Session Name: wuhCor1_ProPro2
Genome Assembly: wuhCor1
Creation Date: 2021-08-04
Views: 1256 		1628064000 1256
Description: The genes HBB and HBD are both expressed in red blood cells, but HBB is also expressed in many other tissues, whereas HBD is expressed in red cells alomst exclusively.
Author: EJ
Session Name: hg19_hemoglobin
Genome Assembly: hg19
Creation Date: 2021-08-03
Views: 1249 		1627977600 1249
Description:
Author: gonzalezvl
Session Name: pha_v1_ncbi
Genome Assembly: hub_2958085_pha_v1_ncbi
Creation Date: 2021-08-02
Views: 1306 		1627891200 1306
Description:
Author: nkfarah
Session Name: snATAC_cerebellum_E12_14
Genome Assembly: mm10
Creation Date: 2021-07-27
Views: 1192 		1627372800 1192
Description: The gene HBB and HBD are both expressed in red blood cells, but HBB is also expressed in many other tissues, where as HBD is expressed in red cells almost exclusively.
Author: mw1278
Session Name: hg19_hemoglobin
Genome Assembly: hg19
Creation Date: 2021-08-31
Views: 1147 		1630396800 1147
Description: This session has Times font selected and italic styling applied, available from the Genome Browser menu -> Configure page (or "c f" shortcut).
Author: PublicSessions
Session Name: Drosophila Duplication with font
Genome Assembly: dm6
Creation Date: 2021-07-21
Views: 1166 		1626854400 1166
Description:
Author: jmorlan66
Session Name: PFS_session8
Genome Assembly: hg38
Creation Date: 2021-07-20
Views: 1194 		1626768000 1194
Description:
Author: Hanson258
Session Name: H3K27me3_myoblast
Genome Assembly: hg38
Creation Date: 2021-07-16
Views: 1328 		1626422400 1328
Description: chıpseq result
Author: hkarakoyun23@ku.edu.tr
Session Name: hazals.
Genome Assembly: hg38
Creation Date: 2024-06-12
Views: 342 		1718179200 342
Description:
Author: Jinkil_Jeong
Session Name: Shig_Ad
Genome Assembly: hg19
Creation Date: 2021-07-07
Views: 1209 		1625644800 1209
Description:
Author: MatthewMurry
Session Name: danRer11
Genome Assembly: danRer11
Creation Date: 2021-07-07
Views: 1189 		1625644800 1189
Description:
Author: smorabito
Session Name: AD_snATAC
Genome Assembly: hg38
Creation Date: 2021-07-07
Views: 1815 		1625644800 1815
Description: Human HOX 11 gene mapped on the positive RLFS readings in the bed file.
Author: arazavi1
Session Name: HOX
Genome Assembly: hg19
Creation Date: 2021-07-07
Views: 1222 		1625644800 1222
Description: This variant affecting Type 1 collagen is identified as a genetic basis for classical EDS and vascular EDS from this source: https://www.ehlers-danlos.com/eds-types/ This session displays SNV clinically oriented annotation tracks at this locus. A paper describing these tracks and the feature that launches them, "Variant Interpretation: UCSC Genome Browser Recommended Track Sets" is in press (pre-print here: https://www.authorea.com/users/423801/articles/529043-variant-interpretation-ucsc-genome-browser-recommended-track-sets)
Author: Kate
Session Name: Ehlers-Danlos Syndrome COL5A1 variant locus (c.934C>T)
Genome Assembly: hg19
Creation Date: 2021-07-08
Views: 1279 		1625731200 1279
Description:
Author: Albert Cheng
Session Name: hg38_JACKIE
Genome Assembly: hg38
Creation Date: 2021-07-01
Views: 1182 		1625126400 1182
Description:
Author: Albert Cheng
Session Name: mm10_JACKIE
Genome Assembly: mm10
Creation Date: 2021-07-01
Views: 1215 		1625126400 1215
Description: A picture of an assembly hub for Zebu cattle where the current DNA in the region has been sent to the External Tool RSAT Metazoa which discovered a motif, aaacttatagata, within the region. The motif was then highlighted with the Short Match track. The session shows how building assembly hubs enables interoperability with tools beyond the UCSC Genome Browser. To access the External Tools pop-up menu, when browsing a genome hover over the "View" menu and then select External Tools.
Author: PublicSessions
Session Name: ExternalTools
Genome Assembly: hub_2100979_GCF_000247795.1
Creation Date: 2021-07-23
Views: 1358 		1627027200 1358
Description:
Author: ashleywilkins
Session Name: hg19 RHO
Genome Assembly: hg19
Creation Date: 2021-09-06
Views: 1189 		1630915200 1189
Description:
Author: Schne2lk
Session Name: hg38 RHO
Genome Assembly: hg38
Creation Date: 2021-09-06
Views: 1146 		1630915200 1146
Description:
Author: artman1967
Session Name: hg19_IBR finale 061521
Genome Assembly: hg19
Creation Date: 2021-06-15
Views: 1240 		1623744000 1240
Description:
Author: Shevelyov
Session Name: LaminDamID in SpG and SpCs
Genome Assembly: dm3
Creation Date: 2021-06-12
Views: 1338 		1623484800 1338
Description:
Author: PolinaKananykina
Session Name: polina_kananykina
Genome Assembly: hg19
Creation Date: 2021-06-09
Views: 1181 		1623225600 1181
Description:
Author: labashmanov
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2021-06-09
Views: 1310 		1623225600 1310
Description:
Author: PolinaKananykina
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2021-06-09
Views: 1177 		1623225600 1177
Description:
Author: art591
Session Name: hse21_H3K27ac_MCF-7_human
Genome Assembly: hg19
Creation Date: 2021-06-09
Views: 1177 		1623225600 1177
Description: THRB
Author: Ruffi2ec
Session Name: Ruffing_ Lab 4-10 THRB
Genome Assembly: mm9
Creation Date: 2024-04-10
Views: 380 		1712736000 380
Description: PDE6A
Author: Ruffi2ec
Session Name: Ruffing_ Lab 4-10 PDE6A
Genome Assembly: mm9
Creation Date: 2024-04-10
Views: 406 		1712736000 406
Description: RHO edit
Author: Ruffi2ec
Session Name: Ruffing_ Lab 4-10 RHO
Genome Assembly: mm9
Creation Date: 2024-04-10
Views: 378 		1712736000 378
Description: TADs_CTCF_Histone_RNAseq_030621
Author: ankurucsc
Session Name: TADs_CTCF_Histone_RNAseq_030621
Genome Assembly: mm10
Creation Date: 2021-06-03
Views: 55 		1622707200 55
Description:
Author: xiaolinwei123
Session Name: hg38_gata6
Genome Assembly: hg38
Creation Date: 2021-05-26
Views: 1155 		1622016000 1155
Description:
Author: Xenia
Session Name: DNA methilarion 14chr
Genome Assembly: mm10
Creation Date: 2021-05-24
Views: 1216 		1621843200 1216
Description:
Author: gemtang
Session Name: histone
Genome Assembly: hg38
Creation Date: 2021-06-04
Views: 1194 		1622793600 1194
Description:
Author: Maksimov_Denis
Session Name: RNA_seq
Genome Assembly: mm10
Creation Date: 2021-05-24
Views: 1285 		1621843200 1285
Description: Regions on GRCh37 where discordant exome variant calls are enriched when mapped on GRCh38.
Author: mdawood
Session Name: DISCREPS_GRCh37
Genome Assembly: hg19
Creation Date: 2021-05-17
Views: 1681 		1621238400 1681
Description: Regions on GRCh38 where discordant exome variant calls are enriched when mapped on GRCh37.
Author: mdawood
Session Name: DISCREPs_GRCh38
Genome Assembly: hg38
Creation Date: 2021-05-17
Views: 1432 		1621238400 1432
Description:
Author: jojobajo
Session Name: SarkisyanA
Genome Assembly: mm10
Creation Date: 2021-05-17
Views: 1251 		1621238400 1251
Description:
Author: manu90
Session Name: paciente2_trasloca
Genome Assembly: hg19
Creation Date: 2021-05-12
Views: 1274 		1620806400 1274
Description:
Author: manu90
Session Name: ZMIZ
Genome Assembly: hg19
Creation Date: 2021-05-12
Views: 1498 		1620806400 1498
Description:
Author: Maksimov_Denis
Session Name: chromatine states
Genome Assembly: hg19
Creation Date: 2021-05-11
Views: 1238 		1620720000 1238
Description: tRNA2
Author: ck-j
Session Name: tRNA2
Genome Assembly: hg38
Creation Date: 2022-12-27
Views: 758 		1672128000 758
Description:
Author: eva re
Session Name: mm10_er
Genome Assembly: mm10
Creation Date: 2021-05-10
Views: 1179 		1620633600 1179
Description:
Author: eva re
Session Name: mm10
Genome Assembly: mm10
Creation Date: 2021-05-10
Views: 1177 		1620633600 1177
Description:
Author: jdpachec
Session Name: Pacheco-PS2-ACE2-session
Genome Assembly: hg19
Creation Date: 2021-05-01
Views: 1218 		1619856000 1218
Description:
Author: amatsiev
Session Name: Matsiev-PS2-ACE2-session
Genome Assembly: hg19
Creation Date: 2021-04-30
Views: 1247 		1619769600 1247
Description:
Author: kailasdhond
Session Name: BME 110 PS 2
Genome Assembly: hg19
Creation Date: 2021-04-30
Views: 1535 		1619769600 1535
Description:
Author: mbule
Session Name: Bule-PS2-ACE2-session
Genome Assembly: hg19
Creation Date: 2021-04-30
Views: 1260 		1619769600 1260
Description:
Author: mai.baker
Session Name: hg38_SAT1_bed
Genome Assembly: hg38
Creation Date: 2021-04-28
Views: 1233 		1619596800 1233
Description:
Author: beoungle
Session Name: hg19 enhancer and infos
Genome Assembly: hg19
Creation Date: 2021-04-26
Views: 2002 		1619424000 2002
Description:
Author: ramace
Session Name: Mace--PS2-ACE2-session
Genome Assembly: hg19
Creation Date: 2021-04-25
Views: 1176 		1619337600 1176
Description:
Author: Maksimov_Denis
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2021-05-11
Views: 1213 		1620720000 1213
Description:
Author: abenet
Session Name: HumanMutationFig2
Genome Assembly: hg19
Creation Date: 2021-05-19
Views: 1363 		1621411200 1363
Description:
Author: abenet
Session Name: HumanMutationFig4
Genome Assembly: hg19
Creation Date: 2021-05-19
Views: 1314 		1621411200 1314
Description:
Author: jojshelt
Session Name: ACE 2 04/17/21
Genome Assembly: hg38
Creation Date: 2021-04-17
Views: 1194 		1618646400 1194
Description:
Author: jojshelt
Session Name: SARS CoV 2 04/15/21
Genome Assembly: wuhCor1
Creation Date: 2021-04-15
Views: 3412 		1618473600 3412
Description:
Author: gatupovmikhail
Session Name: mm10_hw1
Genome Assembly: mm10
Creation Date: 2021-04-14
Views: 3013 		1618387200 3013
Description:
Author: Maksimov_Denis
Session Name: bisulfite sequencing
Genome Assembly: mm10
Creation Date: 2021-04-14
Views: 1225 		1618387200 1225
Description: Public session with the basic tracks to identify putative endothelial enhancers, as described in the published method chapter: Neal A, Rodriguez-Caro H, De Val S. Finding and Verifying Enhancers for Endothelial-Expressed Genes. Methods Mol Biol. 2022;2441:351-368. doi: 10.1007/978-1-0716-2059-5_28. PMID: 35099751. If used, please cite the publication. Author: Helena Rodriguez-Caro
Author: HRC
Session Name: AngiogenesisProtocol_2021_DeVal
Genome Assembly: hg19
Creation Date: 2021-04-09
Views: 1283 		1617955200 1283
Description:
Author: qscmki
Session Name: WT-RNA-ribo-seq
Genome Assembly: mm10
Creation Date: 2021-04-08
Views: 1333 		1617868800 1333
Description:
Author: JFormosa
Session Name: Hwk6Pt3
Genome Assembly: hg19
Creation Date: 2022-02-22
Views: 904 		1645516800 904
Description: This session shows a heat map display using bigBed tracks. A new bigHeat python program helps build a heat-map style display of tracks in various colors. It takes an input BED file and an expression-matrix and generates one bigBed file per column, colored by the values in the matrix. For SARS-2 there are assays where peptides are spotted onto a microarray and antibodies extracted from blood are run over the array and the bigHeat tool was created to aid in visualizing this microarray type data into a collection of stacked tracks in the Browser seen in this session.
Author: brianlee
Session Name: HeatMap
Genome Assembly: wuhCor1
Creation Date: 2021-04-06
Views: 1242 		1617696000 1242
Description:
Author: ldebiasio
Session Name: DeBiaso-PS2-ACE2-session
Genome Assembly: hg19
Creation Date: 2021-04-27
Views: 1222 		1619510400 1222
Description:
Author: marijazzz
Session Name: mm10
Genome Assembly: mm10
Creation Date: 2021-03-28
Views: 1328 		1616918400 1328
Description:
Author: asalisbury1
Session Name: mm9999
Genome Assembly: mm9
Creation Date: 2021-03-25
Views: 1304 		1616659200 1304
Description:
Author: vrlopez
Session Name: Spring 22 Yeast test VL
Genome Assembly: sacCer3
Creation Date: 2022-01-28
Views: 935 		1643356800 935
Description:
Author: Cornelia
Session Name: danRer10_pEGFP-N1_RNA
Genome Assembly: danRer10
Creation Date: 2021-03-04
Views: 1288 		1614844800 1288
Description:
Author: butlertj3
Session Name: sars_cov2_g4_stem-loops
Genome Assembly: wuhCor1
Creation Date: 2020-11-26
Views: 1526 		1606377600 1526
Description: This session shows ChIP-on-ChEP-seq data from Macaca fascicularis testis for H3K27Ac, REC8, RAD21L, SMC1B, STAG3, CTCF, and BORIS/CTCFL. Data in this session are from the PNAS paper: A. Boukaba, J. Liu, C. Ward, Q. Wu1, A. Arnaoutov, J. Liang1, E. M. Pugacheva, M. Dasso, V. Lobanenkov, M. Esteban, and A. V. Strunnikov (2022) Ectopic expression of meiotic cohesin generates chromosome instability in cancer cell line. Proc Natl Acad Sci U S A. Oct 4;119(40):e2204071119. doi: 10.1073/pnas.2204071119.
Author: Strunnik
Session Name: cohesins_CTCF_BORIS_K27Ac_macFas5_pub
Genome Assembly: macFas5
Creation Date: 2021-02-28
Views: 1034 		1614499200 1034
Description:
Author: jhj981111
Session Name: Pde4b
Genome Assembly: mm10
Creation Date: 2021-03-02
Views: 1277 		1614672000 1277
Description:
Author: Mohamed Hisham
Session Name: hg19-HBB
Genome Assembly: hg19
Creation Date: 2021-03-02
Views: 1227 		1614672000 1227
Description:
Author: veronicaburns
Session Name: mm10_210225
Genome Assembly: mm10
Creation Date: 2021-02-25
Views: 1468 		1614240000 1468
Description:
Author: abenet
Session Name: HumanMutationFig3
Genome Assembly: hg19
Creation Date: 2021-05-19
Views: 1225 		1621411200 1225
Description:
Author: elencampoy
Session Name: HsInv0124
Genome Assembly: hg19
Creation Date: 2021-02-24
Views: 1396 		1614153600 1396
Description:
Author: elencampoy
Session Name: HsInv1057
Genome Assembly: hg19
Creation Date: 2021-02-24
Views: 1461 		1614153600 1461
Description:
Author: elencampoy
Session Name: HsInv1051
Genome Assembly: hg19
Creation Date: 2021-02-24
Views: 1457 		1614153600 1457
Description:
Author: elencampoy
Session Name: HsInv0830
Genome Assembly: hg19
Creation Date: 2021-02-24
Views: 1223 		1614153600 1223
Description:
Author: elencampoy
Session Name: HsInv0403
Genome Assembly: hg19
Creation Date: 2021-02-24
Views: 1398 		1614153600 1398
Description:
Author: elencampoy
Session Name: HsInv0397
Genome Assembly: hg19
Creation Date: 2021-02-24
Views: 1268 		1614153600 1268
Description:
Author: elencampoy
Session Name: HsInv0395
Genome Assembly: hg19
Creation Date: 2021-02-24
Views: 1220 		1614153600 1220
Description:
Author: elencampoy
Session Name: HsInv0393
Genome Assembly: hg19
Creation Date: 2021-02-24
Views: 1229 		1614153600 1229
Description:
Author: elencampoy
Session Name: HsInv0390
Genome Assembly: hg19
Creation Date: 2021-02-24
Views: 1298 		1614153600 1298
Description:
Author: elencampoy
Session Name: hsinv0389
Genome Assembly: hg19
Creation Date: 2021-02-24
Views: 1225 		1614153600 1225
Description:
Author: elencampoy
Session Name: HsInv0370
Genome Assembly: hg19
Creation Date: 2021-02-23
Views: 1272 		1614067200 1272
Description:
Author: elencampoy
Session Name: HsInv1124
Genome Assembly: hg19
Creation Date: 2021-02-23
Views: 1283 		1614067200 1283
Description:
Author: elencampoy
Session Name: HsInv0290
Genome Assembly: hg19
Creation Date: 2021-02-23
Views: 1228 		1614067200 1228
Description:
Author: arthurcheng
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2021-02-20
Views: 1258 		1613808000 1258
Description: Genome-wide profiling of histone H1 variants and H3K9me3 in T47D-MTVL cells upon multiple H1 depletion.
Author: NSP
Session Name: GSE156036_GSE166645
Genome Assembly: hg19
Creation Date: 2020-09-08
Views: 1641 		1599552000 1641
Description:
Author: elencampoy
Session Name: HsInv0786
Genome Assembly: hg19
Creation Date: 2021-02-18
Views: 1258 		1613635200 1258
Description:
Author: elencampoy
Session Name: HsInv0344
Genome Assembly: hg19
Creation Date: 2021-02-18
Views: 1216 		1613635200 1216
Description:
Author: elencampoy
Session Name: HsInv0340
Genome Assembly: hg19
Creation Date: 2021-02-23
Views: 1264 		1614067200 1264
Description:
Author: elencampoy
Session Name: HsInv0228
Genome Assembly: hg19
Creation Date: 2021-02-23
Views: 1219 		1614067200 1219
Description:
Author: elencampoy
Session Name: HsInv0396
Genome Assembly: hg19
Creation Date: 2021-02-17
Views: 1264 		1613548800 1264
Description:
Author: elencampoy
Session Name: hsinv0097
Genome Assembly: hg19
Creation Date: 2021-02-17
Views: 1254 		1613548800 1254
Description: Posterior Column Ataxia with Retinitis Pigmentosa (PCARP) is a genetic disorder caused by mutations in the FLVCR1 gene that codes for Feline Leukemia Virus Subgroup C Cellular Receptor 1. Mutations in this heme transport protein, can lead to heme toxicity which affects vision and the nervous system. Symptoms begin in childhood and can include Tunnel-like visual loss, night blindness, and photophobia. Through adulthood sensory function decreases, and symptoms of atrophy, loss of touch, and scoliosis, are common. There are four variants of the FLVCR1 gene that cause PCARP. Puffenburger et. al identified a novel variant at position 361 of the FLCR1 gene, an Asparagine-to-Aspartic Acid, missense mutation which is highlighted blue. The Puffenburger variant (blue) is the current focus of the track, if you zoom to see the whole FLVCR gene you will see there are three other variants designated by the OMIM Alleles Track. Two additional variants are also located in exon 1, and a third in exon 8. At position 574 there is a variant resulting in a cysteine-to-arginine missense mutation which is highlighted green, and at position 721, an alanine-to-threonine missense mutation which is highlighted yellow. In Exon 8 at position 1477 there is a variant resulting in a glycine-to-arginine missense mutation. The Clinvar Variants track classifies all four as pathogenic missense mutations. Pathogenic and Likely Pathogenic variants are colored red, benign variants are colored green, and variants of uncertain significance are colored gray. The Conservation track shows that the regions where all four variants are highly conserved across several species. There is no amino acid variation between chimps, dogs, cattle, cattle, mice, fowl, and zebrafish. Conservation across all of these species indicates these regions are important to vertebrates, and explains why these missense mutations are damaging.
Author: jrhemm
Session Name: Juniata Bioinformatics JHNH
Genome Assembly: hg19
Creation Date: 2021-02-11
Views: 1270 		1613030400 1270
Description: This session shows bosTau9 for a gene also found in Human_PIK3CG which was described in a PAG 2020 meeting.
Author: brianlee
Session Name: bosTau9_Human_PIK3CG
Genome Assembly: bosTau9
Creation Date: 2021-02-12
Views: 1258 		1613116800 1258
Description:
Author: soniagoozee
Session Name: bushbaby
Genome Assembly: hg38
Creation Date: 2021-02-11
Views: 1174 		1613030400 1174
Description:
Author: elencampoy
Session Name: inversions
Genome Assembly: hg19
Creation Date: 2021-02-11
Views: 1254 		1613030400 1254
Description:
Author: raceschaeffer
Session Name: mm10_task2_int
Genome Assembly: mm10
Creation Date: 2021-02-10
Views: 1253 		1612944000 1253
Description:
Author: raceschaeffer
Session Name: mm10_task1
Genome Assembly: mm10
Creation Date: 2021-02-10
Views: 1640 		1612944000 1640
Description:
Author: joel_mundkl
Session Name: Alg 13 w/ tracks
Genome Assembly: mm10
Creation Date: 2021-02-10
Views: 1299 		1612944000 1299
Description:
Author: joel_mundkl
Session Name: All 3 tracks session
Genome Assembly: mm10
Creation Date: 2021-02-10
Views: 1220 		1612944000 1220
Description:
Author: joel_mundkl
Session Name: Gli3 and HH tracks
Genome Assembly: mm10
Creation Date: 2021-02-10
Views: 1432 		1612944000 1432
Description:
Author: joel_mundkl
Session Name: Gli3 limb binding mm10 (ptch1)
Genome Assembly: mm10
Creation Date: 2021-02-10
Views: 1233 		1612944000 1233
Description:
Author: qhernand
Session Name: Hernandez-PS2-ACE2-session
Genome Assembly: hg19
Creation Date: 2021-04-30
Views: 1449 		1619769600 1449
Description:
Author: alecmilazzo
Session Name: mm10_1
Genome Assembly: mm10
Creation Date: 2021-02-09
Views: 1702 		1612857600 1702
Description:
Author: as3838
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2021-02-08
Views: 1306 		1612771200 1306
Description:
Author: PaoloM1990
Session Name: ACTB_qPCR primers
Genome Assembly: hg19
Creation Date: 2021-02-02
Views: 1645 		1612252800 1645
Description:
Author: mdrcetin
Session Name: hg38_encode_bcell_cd34myeloidprogenitor_naturalkiller
Genome Assembly: hg38
Creation Date: 2021-11-16
Views: 970 		1637049600 970
Description:
Author: mdrcetin
Session Name: hg38_encode_ucsf4_hyyees64_h1_h9
Genome Assembly: hg38
Creation Date: 2021-11-16
Views: 1480 		1637049600 1480
Description:
Author: mdrcetin
Session Name: hg38_k562_encode_minus_strand_only
Genome Assembly: hg38
Creation Date: 2021-11-16
Views: 960 		1637049600 960
Description:
Author: molcov
Session Name: Human Duplication
Genome Assembly: hg19
Creation Date: 2021-01-31
Views: 1298 		1612080000 1298
Description: only_H3k27me3_2m_8m_peaks_rose_recognicer_sicer
Author: ankurucsc
Session Name: only_H3k27me3_2m_8m_peaks_rose_recognicer_sicer
Genome Assembly: mm10
Creation Date: 2021-01-29
Views: 36 		1611907200 36
Description: coronavirus spike protein region with some relevant tracks turned on, including variants of concern (VoC).
Author: Example
Session Name: wuhCor1_spike
Genome Assembly: wuhCor1
Creation Date: 2021-01-25
Views: 3634 		1611561600 3634
Description: ROSE_epaks_chr1_2M_8Monly
Author: ankurucsc
Session Name: ROSE_epaks_chr1_2M_8Monly
Genome Assembly: mm10
Creation Date: 2021-01-23
Views: 26 		1611388800 26
Description: ROSE_peaks_chr1_2M_only
Author: ankurucsc
Session Name: ROSE_peaks_chr1_2M_only
Genome Assembly: mm10
Creation Date: 2021-01-23
Views: 34 		1611388800 34
Description:
Author: Dongyao_Liu
Session Name: mm9_BAML1_and_CLOCK
Genome Assembly: mm9
Creation Date: 2021-04-13
Views: 1205 		1618300800 1205
Description: The hub shows association of copy number changes of VNTRs (Variable Number Tander Repeat) with local gene expression and CpG methylation in two discovery cohorts ane one replication cohort for which PCR-free Illumina WGS data were available.<br> Read more here: https://gargp01.u.hpc.mssm.edu/ucsc_exp_meth_vntr.html
Author: brianlee
Session Name: VNTR
Genome Assembly: hg19
Creation Date: 2021-01-22
Views: 1296 		1611302400 1296
Description:
Author: elencampoy
Session Name: Hsinv0209
Genome Assembly: hg19
Creation Date: 2021-02-23
Views: 1250 		1614067200 1250
Description:
Author: elencampoy
Session Name: HsInv0030
Genome Assembly: hg19
Creation Date: 2021-02-23
Views: 1237 		1614067200 1237
Description:
Author: BOPOHDR
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2021-01-12
Views: 1739 		1610438400 1739
Description: session5_120121_RECOGNICER_SICER_peaks
Author: ankurucsc
Session Name: session5_120121_RECOGNICER_SICER_peaks
Genome Assembly: mm10
Creation Date: 2021-01-11
Views: 30 		1610352000 30
Description: Session4_120121_SICER_RECOGNICER_peaks
Author: ankurucsc
Session Name: Session4_120121_SICER_RECOGNICER_peaks
Genome Assembly: mm10
Creation Date: 2021-01-11
Views: 29 		1610352000 29
Description: session3_120121_SICER_RECOGNICER
Author: ankurucsc
Session Name: session3_120121_SICER_RECOGNICER
Genome Assembly: mm10
Creation Date: 2021-01-11
Views: 28 		1610352000 28
Description: Sesssion2_120121_RECOGNICER_H3K27_K9me3_FDRs_2M_8M
Author: ankurucsc
Session Name: Sesssion2_120121_RECOGNICER_H3K27_K9me3_FDRs_2M_8M
Genome Assembly: mm10
Creation Date: 2021-01-11
Views: 30 		1610352000 30
Description: session_1_120121_RECOGNICER_H3K27me3_FDRs_2M_8M
Author: ankurucsc
Session Name: session_1_120121_RECOGNICER_H3K27me3_FDRs_2M_8M
Genome Assembly: mm10
Creation Date: 2021-01-11
Views: 24 		1610352000 24
Description:
Author: ashleywilkins
Session Name: hg19 RHO 2
Genome Assembly: hg19
Creation Date: 2021-09-06
Views: 1171 		1630915200 1171
Description: CAG repeats found in the RUNX2 gene. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: anom_fig9
Genome Assembly: hg19
Creation Date: 2022-08-19
Views: 888 		1660896000 888
Description: Zoom in on CAG repeats found in the gene MED12. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: anom_fig7
Genome Assembly: hg19
Creation Date: 2022-08-19
Views: 881 		1660896000 881
Description: Two different areas of CAG repeats found in the MED12 gene. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: anom_fig6
Genome Assembly: hg19
Creation Date: 2022-08-19
Views: 1003 		1660896000 1003
Description:
Author: as3838
Session Name: PATRICKDATA
Genome Assembly: hg19
Creation Date: 2021-02-08
Views: 1359 		1612771200 1359
Description:
Author: AnnaClaireR1
Session Name: mm10_3tracks
Genome Assembly: mm10
Creation Date: 2021-02-01
Views: 1522 		1612166400 1522
Description:
Author: AnnaClaireR1
Session Name: mm10_testupload
Genome Assembly: mm10
Creation Date: 2021-02-01
Views: 1311 		1612166400 1311
Description: ForEncode_data_comaparison_080121
Author: ankurucsc
Session Name: ForEncode_data_comaparison_080121
Genome Assembly: mm10
Creation Date: 2021-01-07
Views: 30 		1610006400 30
Description:
Author: PaoloM1990
Session Name: GAPDH_qPCR primers
Genome Assembly: hg19
Creation Date: 2021-02-02
Views: 1285 		1612252800 1285
Description:
Author: PaoloM1990
Session Name: ATP6V0E1_qPCR primers
Genome Assembly: hg19
Creation Date: 2021-02-02
Views: 1231 		1612252800 1231
Description:
Author: PaoloM1990
Session Name: GBA_qPCR primers
Genome Assembly: hg19
Creation Date: 2021-02-02
Views: 1323 		1612252800 1323
Description:
Author: PaoloM1990
Session Name: CTSD_qPCR primers
Genome Assembly: hg19
Creation Date: 2021-02-02
Views: 1193 		1612252800 1193
Description:
Author: PaoloM1990
Session Name: CTSB_qPCR primers
Genome Assembly: hg19
Creation Date: 2021-02-02
Views: 1326 		1612252800 1326
Description:
Author: PaoloM1990
Session Name: CTSL_qPCR primers
Genome Assembly: hg19
Creation Date: 2021-02-02
Views: 1253 		1612252800 1253
Description:
Author: PaoloM1990
Session Name: MCOLN1_qPCR primers
Genome Assembly: hg19
Creation Date: 2021-02-02
Views: 1397 		1612252800 1397
Description:
Author: AnnaClaireR1
Session Name: mm10_smoc
Genome Assembly: mm10
Creation Date: 2021-02-02
Views: 1564 		1612252800 1564
Description: This session helps demonstrate the Simple Tandem Repeats by TRF track. It includes a Short Match track that is simply highlighting the sequence <b>ctctcgct</b> within the window and this reflects how a programmatic approach can annotate the genome, where the Tandem Repeats Finder (TRF) program helps discover and annotate possibly imperfect repeats as well as exact matches. Users who are interested in STRs may want to look at a resource called STRBase https://strbase.nist.gov/index.htm which was founded in 2001 and includes a Variant Allele Reports page for those searching for allele or frequency count information.
Author: brianlee
Session Name: hg38_STR
Genome Assembly: hg38
Creation Date: 2021-01-07
Views: 1629 		1610006400 1629
Description: This session shows an assembly hub on mink that can be loaded with this quick link: https://genome.ucsc.edu/h/GCA_900108605.1<br> The link can also be searched with the position= term: https://genome.ucsc.edu/h/GCA_900108605.1?position=ACE2 <br> It can also have custom data displayed on it, in this case an interact file that can be loaded under My Data and Custom Tracks.
Author: brianlee
Session Name: Mink_hub_interact
Genome Assembly: hub_2637617_GCA_900108605.1
Creation Date: 2021-01-07
Views: 1552 		1610006400 1552
Description: Fresh_session_07012021_ChIPseq_2M_8M_3C_compartment_TAD
Author: ankurucsc
Session Name: Fresh_session_07012021_ChIPseq_2M_8M_3C_compartment_TAD
Genome Assembly: mm10
Creation Date: 2021-01-06
Views: 55 		1609920000 55
Description:
Author: sarahjc
Session Name: FM GR ChIP Miseq
Genome Assembly: hg38
Creation Date: 2021-01-02
Views: 1460 		1609574400 1460
Description:
Author: BOPOHDR
Session Name: GRCh37_CNV_SNV_2
Genome Assembly: hg19
Creation Date: 2020-12-21
Views: 1444 		1608537600 1444
Description:
Author: Libby3121
Session Name: mm39 FoxA2 sites
Genome Assembly: mm39
Creation Date: 2020-12-20
Views: 1365 		1608451200 1365
Description:
Author: BOPOHDR
Session Name: GRCh37_CNV_SNV
Genome Assembly: hg19
Creation Date: 2020-12-19
Views: 1972 		1608364800 1972
Description:
Author: solbru
Session Name: hg19_TANGO6
Genome Assembly: hg19
Creation Date: 2020-12-18
Views: 1568 		1608278400 1568
Description:
Author: molcov
Session Name: Drosophila Duplication
Genome Assembly: dm6
Creation Date: 2021-01-30
Views: 1336 		1611993600 1336
Description:
Author: joliemb
Session Name: mm10
Genome Assembly: mm10
Creation Date: 2021-02-04
Views: 1304 		1612425600 1304
Description:
Author: mongerc
Session Name: mm10BMI1
Genome Assembly: mm10
Creation Date: 2020-12-16
Views: 1507 		1608105600 1507
Description:
Author: mongerc
Session Name: Brien2020AllTracks
Genome Assembly: hg38
Creation Date: 2020-12-07
Views: 1507 		1607328000 1507
Description:
Author: mongerc
Session Name: Brien2020ChIP-RX
Genome Assembly: hg38
Creation Date: 2020-12-07
Views: 1465 		1607328000 1465
Description:
Author: JZhaoARUP
Session Name: hg19_ARUP_CMA_multi_gene
Genome Assembly: hg19
Creation Date: 2020-11-14
Views: 2427 		1605340800 2427
Description:
Author: JZhaoARUP
Session Name: hg19_ARUP_CMA_single_gene
Genome Assembly: hg19
Creation Date: 2020-11-14
Views: 1849 		1605340800 1849
Description:
Author: sarahjc
Session Name: Nextseq Dedup ESF BAC SS 113020
Genome Assembly: hg38
Creation Date: 2020-11-30
Views: 1435 		1606723200 1435
Description:
Author: ustiugova_al
Session Name: au
Genome Assembly: hg38
Creation Date: 2020-11-27
Views: 1470 		1606464000 1470
Description: Shown in Fig 1 of "Using data from the 100,000 Genomes Project to resolve conflicting interpretations of a recurrent TUBB2A mutation" (PMID: 33547136). Shows TUBB2A and positions of de novo variants seen in the 100kGP. Also shown are cismorphisms (red) that differ between TUBB2A, TUBB2B and TUBB4A, TUBB3, TUBB6 and the TUBB2BP1 pseudogene. Primer positions used for variant validation are also plotted.
Author: AlistairP
Session Name: TUBB2A_v5
Genome Assembly: hg38
Creation Date: 2020-11-26
Views: 423 		1606377600 423
Description:
Author: ck-j
Session Name: RNAseq-WT/KO-chr12:113,418,558-113,422,730
Genome Assembly: mm10
Creation Date: 2020-11-21
Views: 983 		1605945600 983
Description:
Author: ck-j
Session Name: PCPB1-chr12:113,418,558-113,422,730
Genome Assembly: mm10
Creation Date: 2020-11-17
Views: 998 		1605600000 998
Description: KJ8Vehicle = 0d +TGFB KJ15eEMT = 2d +TGFB KJ12pEMT = 4d +TGFB KJ14Trans = 4d +TGFB followed by 4d TGFB withdrawal KJ11fMET2 = 4d +TGFB followed by 10d TGFB withdrawal KJ9fEMT = 10d +TGFB KJ13pMET = 10d +TGFB followed by 4d TGFB withdrawal KJ10fMET1 = 10d +TGFB followed by 10d TGFB withdrawal
Author: kelsey_johnson1
Session Name: Reversible EMT ATAC-seq peaks
Genome Assembly: hg19
Creation Date: 2020-11-20
Views: 1403 		1605859200 1403
Description: NRA-Anterograde Regulation of Nuclear-encoded Mitochondrial Genes and FGF21 Signaling by Hepatic Histone Demethylase LSD1
Author: qiushi
Session Name: RNAseq
Genome Assembly: mm10
Creation Date: 2020-11-12
Views: 1507 		1605168000 1507
Description: NRA-Anterograde Regulation of Nuclear-encoded Mitochondrial Genes and FGF21 Signaling by Hepatic Histone Demethylase LSD1
Author: qiushi
Session Name: ChIPseq
Genome Assembly: mm10
Creation Date: 2020-11-12
Views: 1473 		1605168000 1473
Description:
Author: kkaczor
Session Name: cirm_ucla_2
Genome Assembly: hg38
Creation Date: 2020-11-11
Views: 1576 		1605081600 1576
Description:
Author: jranish
Session Name: Castrillo LXR ChIP
Genome Assembly: mm10
Creation Date: 2020-10-27
Views: 1206 		1603785600 1206
Description:
Author: zgtman
Session Name: Genescan_3_hg38_SRY
Genome Assembly: hg38
Creation Date: 2021-01-12
Views: 1695 		1610438400 1695
Description:
Author: manu90
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2020-11-15
Views: 1211 		1605427200 1211
Description:
Author: evechen97
Session Name: EC-39545454-MEDG580-UBC-2020
Genome Assembly: hg38
Creation Date: 2021-10-10
Views: 1173 		1633852800 1173
Description:
Author: aurbanow
Session Name: tammer
Genome Assembly: mm10
Creation Date: 2020-11-25
Views: 1528 		1606291200 1528
Description:
Author: rafal.czapiewski@ed.ac.uk
Session Name: BAC_FOSMID
Genome Assembly: mm9
Creation Date: 2020-10-16
Views: 1726 		1602835200 1726
Description:
Author: psharma
Session Name: 6. PS-75227116-MEDG580-UBC-2020
Genome Assembly: hg38
Creation Date: 2020-10-06
Views: 1412 		1601971200 1412
Description:
Author: williamhconrad
Session Name: TSS-evaluation-lite-2
Genome Assembly: hg19
Creation Date: 2021-10-07
Views: 1116 		1633593600 1116
Description:
Author: williamhconrad
Session Name: TSS-evaluation-lite
Genome Assembly: hg19
Creation Date: 2021-10-07
Views: 1095 		1633593600 1095
Description:
Author: fushenchu
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2020-09-28
Views: 1531 		1601280000 1531
Description: with_CTCF_10jan21
Author: ankurucsc
Session Name: with_CTCF_10jan21
Genome Assembly: mm10
Creation Date: 2021-01-10
Views: 25 		1610265600 25
Description:
Author: federikr
Session Name: CRX
Genome Assembly: hg38
Creation Date: 2020-09-28
Views: 1529 		1601280000 1529
Description: ClinGen tracks show dosage sensitivity (deletion or gains will cause disease or not) of described copy number region (ISCA) and single genes in the region and curation of association of diseases to the genes in these region.
Author: abenet
Session Name: clinical-ClinGenCuration
Genome Assembly: hg19
Creation Date: 2020-09-25
Views: 1521 		1601020800 1521
Description:
Author: zahra jafari
Session Name: homwork
Genome Assembly: hg19
Creation Date: 2021-12-03
Views: 935 		1638518400 935
Description: This session shows a portion of the ALDH2 gene, one of the two genes associated with alcohol intolerance in East Asian populations, in its entirety. The "ClinVar" track is enabled and shows common nucleotide variants in the region. Clicking into a rsID provides more information regarding the phenotypic, and possibly pathogenic, consequences of a variant. Highlighted is rs671, which is the variant that causes “alcohol flush syndrome”; This condition is seen in approximately 30% to 50% of East Asian individuals. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_ALDH2clinvar
Genome Assembly: hg19
Creation Date: 2022-07-21
Views: 877 		1658390400 877
Description:
Author: williamhconrad
Session Name: TSS-evaluation
Genome Assembly: hg19
Creation Date: 2020-09-21
Views: 2192 		1600675200 2192
Description:
Author: kianayaghoobian
Session Name: TAS2R38 UniProt
Genome Assembly: hg19
Creation Date: 2020-09-20
Views: 1491 		1600588800 1491
Description:
Author: kianayaghoobian
Session Name: TAS2R38 group1
Genome Assembly: hg19
Creation Date: 2020-09-20
Views: 1861 		1600588800 1861
Description:
Author: jzhicks07
Session Name: TAS2R38 JMH_1
Genome Assembly: hg19
Creation Date: 2020-09-14
Views: 1563 		1600070400 1563
Description:
Author: manu90
Session Name: TAD!!
Genome Assembly: hg19
Creation Date: 2021-06-03
Views: 1211 		1622707200 1211
Description:
Author: jzhicks07
Session Name: TAS2R38 JMH
Genome Assembly: hg19
Creation Date: 2020-09-12
Views: 1567 		1599897600 1567
Description:
Author: rstarks23
Session Name: e9.5Placenta_HistoneModification
Genome Assembly: mm10
Creation Date: 2020-09-09
Views: 1550 		1599638400 1550
Description:
Author: AMOza
Session Name: LMM_Conservation
Genome Assembly: hg19
Creation Date: 2020-09-09
Views: 1574 		1599638400 1574
Description:
Author: maddieevans9
Session Name: TAS2R38 group(ME,BZ,CB)
Genome Assembly: hg19
Creation Date: 2020-09-09
Views: 2217 		1599638400 2217
Description:
Author: gage2ea
Session Name: Fall20 Worm test group 3
Genome Assembly: ce11
Creation Date: 2020-09-08
Views: 1563 		1599552000 1563
Description:
Author: sconyejekwe
Session Name: Fall20 Mouse test group#5
Genome Assembly: mm9
Creation Date: 2020-09-08
Views: 1300 		1599552000 1300
Description:
Author: calvinc98
Session Name: Fall20 Mouse test group 6
Genome Assembly: mm9
Creation Date: 2020-09-08
Views: 1490 		1599552000 1490
Description:
Author: occamslaser
Session Name: Fall20 Worm test group# 4
Genome Assembly: ce11
Creation Date: 2020-09-08
Views: 1281 		1599552000 1281
Description:
Author: hrbaylous
Session Name: Fall20 yeast test group 1
Genome Assembly: sacCer3
Creation Date: 2020-09-08
Views: 1615 		1599552000 1615
Description:
Author: Haley Yandrasitz
Session Name: Fall20 Mouse Test group#5
Genome Assembly: mm9
Creation Date: 2020-09-08
Views: 1417 		1599552000 1417
Description:
Author: jzhicks07
Session Name: CGEMS yeast JMH test
Genome Assembly: sacCer3
Creation Date: 2020-09-07
Views: 1487 		1599465600 1487
Description:
Author: biologyassignment
Session Name: Fall19 Yeast test (ACG)
Genome Assembly: sacCer3
Creation Date: 2020-09-07
Views: 1582 		1599465600 1582
Description:
Author: ArcherS
Session Name: Fall19 Yeast test A.S.
Genome Assembly: sacCer3
Creation Date: 2020-09-07
Views: 1445 		1599465600 1445
Description:
Author: federikr
Session Name: Fall20 TAS2R38 group#3
Genome Assembly: hg19
Creation Date: 2020-09-07
Views: 1329 		1599465600 1329
Description:
Author: perryts
Session Name: Fall20 Yeast Test (TSP)
Genome Assembly: sacCer3
Creation Date: 2020-09-07
Views: 1474 		1599465600 1474
Description:
Author: maddieevans9
Session Name: Fall20 Yeast test (ME)
Genome Assembly: sacCer3
Creation Date: 2020-09-07
Views: 1541 		1599465600 1541
Description:
Author: lauren_soleo
Session Name: TAS2R38 group 1
Genome Assembly: hg19
Creation Date: 2020-09-07
Views: 1495 		1599465600 1495
Description:
Author: brockse
Session Name: TAS2R38 group 1
Genome Assembly: hg19
Creation Date: 2020-09-07
Views: 1509 		1599465600 1509
Description:
Author: Chadtb220
Session Name: Fall19 Yeast test CTB
Genome Assembly: sacCer3
Creation Date: 2020-09-07
Views: 1552 		1599465600 1552
Description:
Author: AMOza
Session Name: LMM_Conservation_hg38
Genome Assembly: hg38
Creation Date: 2020-09-09
Views: 12006 		1599638400 12006
Description:
Author: kianayaghoobian
Session Name: Fall19 Yeast test KY
Genome Assembly: sacCer3
Creation Date: 2020-09-07
Views: 1716 		1599465600 1716
Description:
Author: KeelynCrossin
Session Name: Fall20 yeast test KGC
Genome Assembly: sacCer3
Creation Date: 2020-09-06
Views: 1441 		1599379200 1441
Description:
Author: JFormosa
Session Name: Hwk6Pt2
Genome Assembly: hg19
Creation Date: 2022-02-22
Views: 853 		1645516800 853
Description:
Author: embdukes
Session Name: Fall20 Yeast test (EDB)
Genome Assembly: sacCer3
Creation Date: 2020-09-06
Views: 1543 		1599379200 1543
Description:
Author: napace
Session Name: Fall19 Yeast test NAP
Genome Assembly: sacCer3
Creation Date: 2020-09-06
Views: 1647 		1599379200 1647
Description:
Author: federikr
Session Name: Fall20 Yeast Test KF
Genome Assembly: sacCer3
Creation Date: 2020-09-06
Views: 1509 		1599379200 1509
Description:
Author: JRozick147
Session Name: wuhCor1-1
Genome Assembly: wuhCor1
Creation Date: 2020-09-05
Views: 1937 		1599292800 1937
Description:
Author: lauren_soleo
Session Name: Fall20 Yeast test LS
Genome Assembly: sacCer3
Creation Date: 2020-09-04
Views: 1476 		1599206400 1476
Description: This session is of the new ALFA (Allele Frequency Aggregator) variants and allele frequency hub. Results from the Allele Frequency Aggregator (ALFA) project will help users interpret the biological impact of common and rare sequence variants. ALFA's initial release includes analysis of genotype data from ~100K unrestricted dbGaP subjects and provides high-quality allele frequency data now displayed on relevant dbSNP records. Eventually ALFA will analyze more than 1M subjects. The current version is for hg38/GRCh38 with work to include hg19/GRCh37 data. Read more about the ALFA project page here: https://www.ncbi.nlm.nih.gov/snp/docs/gsr/alfa
Author: brianlee
Session Name: ALFA_Trio
Genome Assembly: hg38
Creation Date: 2020-09-03
Views: 2040 		1599120000 2040
Description:
Author: brockse
Session Name: Fall20 Yeast Test SB
Genome Assembly: sacCer3
Creation Date: 2020-08-31
Views: 1641 		1598860800 1641
Description: Jan11_2021
Author: ankurucsc
Session Name: Jan11_2021
Genome Assembly: mm10
Creation Date: 2021-01-10
Views: 27 		1610265600 27
Description:
Author: Yuanyuan Zhang
Session Name: Mechanism of 5mC controlled Arabidopsis clock pace
Genome Assembly: hub_329263_araTha1
Creation Date: 2021-01-11
Views: 3701 		1610352000 3701
Description:
Author: mongerc
Session Name: mm10Suz12
Genome Assembly: mm10
Creation Date: 2020-08-28
Views: 1558 		1598601600 1558
Description: A stop codon (marked in red) found at the end of the METTL3 gene, indicating the end of translation, which proceeds right to left for this gene. Below, we can observe how conservation decreases dramatically after the Stop codon in the “PhyloP” data track. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: mettl3_stop
Genome Assembly: hg19
Creation Date: 2022-01-19
Views: 1038 		1642579200 1038
Description:
Author: alfordml
Session Name: Spring22 Yeast test MA
Genome Assembly: sacCer3
Creation Date: 2022-01-25
Views: 932 		1643097600 932
Description:
Author: gera912
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2020-08-11
Views: 1530 		1597132800 1530
Description:
Author: feng xue
Session Name: kdm4c
Genome Assembly: hg17
Creation Date: 2020-08-10
Views: 1848 		1597046400 1848
Description:
Author: shuynhs
Session Name: SH-61951083-MEDG580-UBC-2020
Genome Assembly: hg38
Creation Date: 2020-10-05
Views: 1521 		1601884800 1521
Description: Session of ASHG 2020 Figure 2. Displays Hi-C track format with custom display options (score normalization, display color, arc display).
Author: Lou
Session Name: ASHG2
Genome Assembly: hg19
Creation Date: 2020-10-05
Views: 1577 		1601884800 1577
Description: Session of ASHG 2020 Figure 1. Displays Hi-C track format with default settings. Additional tracks include UCSC Genes, ChIP-seq signal track from ENCODE, and GeneHancer clustered interactions.
Author: Lou
Session Name: ASHG1
Genome Assembly: hg19
Creation Date: 2020-10-05
Views: 1566 		1601884800 1566
Description:
Author: boothc
Session Name: Fish n Chips detailed
Genome Assembly: danRer10
Creation Date: 2020-08-04
Views: 1579 		1596528000 1579
Description:
Author: elencampoy
Session Name: HsInv0573
Genome Assembly: hg19
Creation Date: 2021-02-18
Views: 1260 		1613635200 1260
Description:
Author: jzhicks07
Session Name: CRX 9.28 JMH
Genome Assembly: hg38
Creation Date: 2020-09-28
Views: 1500 		1601280000 1500
Description:
Author: simonwang612
Session Name: Ying_ATAC_GSDMD
Genome Assembly: mm10
Creation Date: 2020-07-23
Views: 1962 		1595491200 1962
Description:
Author: simonwang612
Session Name: Ying_ATACseq_peaks
Genome Assembly: mm10
Creation Date: 2020-07-23
Views: 1989 		1595491200 1989
Description:
Author: simonwang612
Session Name: atac_Ying
Genome Assembly: mm10
Creation Date: 2020-07-23
Views: 1709 		1595491200 1709
Description:
Author: simonwang612
Session Name: mm10_atac_Ying
Genome Assembly: mm10
Creation Date: 2020-07-23
Views: 1535 		1595491200 1535
Description:
Author: Lachlan Coin
Session Name: dRNA
Genome Assembly: hg38
Creation Date: 2020-07-22
Views: 1601 		1595404800 1601
Description: Tracks associated with: Buzzi et al. 2022 Sox8 remodels the cranial ectoderm to generate the ear
Author: alexthiery
Session Name: Sox8_otic_reprogramming
Genome Assembly: galGal6
Creation Date: 2021-03-02
Views: 757 		1614672000 757
Description:
Author: Marie-José
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2020-07-28
Views: 1852 		1595923200 1852
Description:
Author: shaghayegh dastjerdi
Session Name: hg19/smad3 new promoters
Genome Assembly: hg19
Creation Date: 2020-07-27
Views: 1592 		1595836800 1592
Description:
Author: Schne2lk
Session Name: hg38 RHO multiomics
Genome Assembly: hg38
Creation Date: 2021-11-16
Views: 1007 		1637049600 1007
Description:
Author: ashleywilkins
Session Name: hg38 retinal multiomics
Genome Assembly: hg38
Creation Date: 2021-11-16
Views: 919 		1637049600 919
Description:
Author: chalie102
Session Name: HDA_ChIP_H3K18ac
Genome Assembly: sacCer3
Creation Date: 2021-02-15
Views: 2375 		1613376000 2375
Description:
Author: vperreau@unimelb.edu.au
Session Name: hg38_NTRK2_blat_probes
Genome Assembly: hg38
Creation Date: 2020-10-12
Views: 1742 		1602489600 1742
Description: Session6_130121_RECOGNICER_SICER_H3K27me3_H3K9me3
Author: ankurucsc
Session Name: Session6_130121_RECOGNICER_SICER_H3K27me3_H3K9me3
Genome Assembly: mm10
Creation Date: 2021-01-12
Views: 32 		1610438400 32
Description:
Author: LalehEbr
Session Name: hg19 UCSC workshop assignment
Genome Assembly: hg19
Creation Date: 2020-07-19
Views: 1968 		1595145600 1968
Description:
Author: fatemeh sadat
Session Name: F
Genome Assembly: hg19
Creation Date: 2020-07-19
Views: 1959 		1595145600 1959
Description:
Author: shaghayegh dastjerdi
Session Name: hg19/dastjerdi
Genome Assembly: hg19
Creation Date: 2020-07-17
Views: 2033 		1594972800 2033
Description:
Author: fatemeh sadat
Session Name: FASc
Genome Assembly: hg19
Creation Date: 2020-07-19
Views: 2203 		1595145600 2203
Description:
Author: shaghayegh dastjerdi
Session Name: hg19/Smad3 promoter
Genome Assembly: hg19
Creation Date: 2020-07-17
Views: 1611 		1594972800 1611
Description: Transcript structures for LncExpDB and LncBook databases
Author: lizhao
Session Name: lncexpdb_UCSC
Genome Assembly: hg38
Creation Date: 2023-09-07
Views: 209674 		1694073600 209674
Description: MetamORF: A repository of unique small Open Reading Frames identified by both experimental and computational approaches for gene-level and meta analyses
Author: schoteau
Session Name: MetamORF (hg38)
Genome Assembly: hg38
Creation Date: 2020-07-14
Views: 1599 		1594713600 1599
Description:
Author: mongerc
Session Name: Brien2020ChipRX
Genome Assembly: hg38
Creation Date: 2020-07-09
Views: 1603 		1594281600 1603
Description:
Author: mongerc
Session Name: Brien2020RNASeq
Genome Assembly: hg38
Creation Date: 2020-07-09
Views: 1681 		1594281600 1681
Description:
Author: mongerc
Session Name: Brien2020ATAC
Genome Assembly: hg38
Creation Date: 2020-07-09
Views: 1599 		1594281600 1599
Description:
Author: Marie-José
Session Name: hg19_TAD
Genome Assembly: hg19
Creation Date: 2020-07-09
Views: 2025 		1594281600 2025
Description:
Author: Stephanie
Session Name: hg19-OXTR
Genome Assembly: hg19
Creation Date: 2020-07-08
Views: 1605 		1594195200 1605
Description: RCRN
Author: Ruffi2ec
Session Name: Ruffing_ Lab 4-10 RCRN
Genome Assembly: mm9
Creation Date: 2024-04-10
Views: 323 		1712736000 323
Description:
Author: Stephanie
Session Name: mm10
Genome Assembly: mm10
Creation Date: 2020-07-08
Views: 1617 		1594195200 1617
Description:
Author: Chen Chunpeng
Session Name: GBM_STAT
Genome Assembly: hg38
Creation Date: 2020-07-14
Views: 1534 		1594713600 1534
Description:
Author: Stephanie
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2020-07-08
Views: 1744 		1594195200 1744
Description:
Author: ranjan99
Session Name: RCas9_HSA_IM
Genome Assembly: mm10
Creation Date: 2020-06-28
Views: 1996 		1593331200 1996
Description:
Author: ustiugova_al
Session Name: cd27
Genome Assembly: hg38
Creation Date: 2020-06-26
Views: 1651 		1593158400 1651
Description:
Author: ccpowell
Session Name: solLy4
Genome Assembly: hub_2266061_solLy4
Creation Date: 2020-06-15
Views: 2525 		1592208000 2525
Description:
Author: Dbakalar
Session Name: Rapgef2 mRNA, promotors, H3K9me3
Genome Assembly: mm10
Creation Date: 2020-06-18
Views: 1790 		1592467200 1790
Description:
Author: Dbakalar
Session Name: Rapgef2 mRNA, promotors, H3K27me3
Genome Assembly: mm10
Creation Date: 2020-06-18
Views: 1567 		1592467200 1567
Description:
Author: Dbakalar
Session Name: Rapgef2 mRNA, promotors, H3K36me3
Genome Assembly: mm10
Creation Date: 2020-06-18
Views: 1531 		1592467200 1531
Description:
Author: Dbakalar
Session Name: Rapgef2 mRNA, promotors, H3K9ac
Genome Assembly: mm10
Creation Date: 2020-06-18
Views: 1482 		1592467200 1482
Description:
Author: Dbakalar
Session Name: Rapgef2 mRNA, promotors, H3K27ac
Genome Assembly: mm10
Creation Date: 2020-06-18
Views: 1612 		1592467200 1612
Description:
Author: Dbakalar
Session Name: Rapgef2 mRNA, promotors, K4me2
Genome Assembly: mm10
Creation Date: 2020-06-18
Views: 1511 		1592467200 1511
Description:
Author: Dbakalar
Session Name: Rapgef2 mRNA, promotors, H3Kme1
Genome Assembly: mm10
Creation Date: 2020-06-18
Views: 1453 		1592467200 1453
Description:
Author: Dbakalar
Session Name: Rapgef2 mRNA, promotors, H4me3
Genome Assembly: mm10
Creation Date: 2020-06-18
Views: 1548 		1592467200 1548
Description:
Author: jeramiahsmith
Session Name: RNAseq_regen_compil
Genome Assembly: hub_1106737_Amex_PQ.v4
Creation Date: 2020-06-17
Views: 1865 		1592380800 1865
Description:
Author: williamhconrad
Session Name: hg19 HCT116 DMR Methylation
Genome Assembly: hg19
Creation Date: 2020-06-09
Views: 1824 		1591689600 1824
Description:
Author: nickeener
Session Name: SARS-CoV-2 Selection
Genome Assembly: wuhCor1
Creation Date: 2020-06-03
Views: 1597 		1591171200 1597
Description:
Author: br1215@nyu.edu
Session Name: ce10_OP_CNV
Genome Assembly: ce10
Creation Date: 2020-06-01
Views: 1735 		1590998400 1735
Screenshot not available
Click Here to view
 Description:
Author: dianegirard
Session Name: H3K27ac_ChIPseq_EPI_hg38
Genome Assembly: hg38
Creation Date: 2020-06-01
Views: 1864 		1590998400 1864
Screenshot not available
Click Here to view
 Description:
Author: dianegirard
Session Name: H3K27ac_ChIPseq_EPICARD_hg38
Genome Assembly: hg38
Creation Date: 2020-05-30
Views: 1946 		1590825600 1946
Screenshot not available
Click Here to view
 Description:
Author: dianegirard
Session Name: H3K27ac_ChIPseq_CARD
Genome Assembly: hg38
Creation Date: 2020-05-30
Views: 1637 		1590825600 1637
Description: Zoomed in on the first exon of the METTL3 gene. If we look at the direction of translation/arrows on the introns, we can see that translation for this gene is going from right to left. Zooming in here, the methionine start codon, colored in green, is observable. Notice how the sequence upstream from the start codon (to the right) is an untranslated region, depicted as a half-height box at the UTR region of the 5’ end. Offscreen to the right is more non-coding RNA (indicated by double white arrows). Only after the start codon does translation actually begin in the right-to-left direction. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: mettl3_exon1
Genome Assembly: hg19
Creation Date: 2022-01-19
Views: 1058 		1642579200 1058
Description: ChIPmera
Author: CGRoque
Session Name: GouveiaRoque_ChIPmera
Genome Assembly: hg38
Creation Date: 2021-04-22
Views: 827 		1619078400 827
Description:
Author: ccpowell
Session Name: solLyc1
Genome Assembly: hub_2224691_solLyc1
Creation Date: 2020-05-25
Views: 1731 		1590393600 1731
Description:
Author: br1215@nyu.edu
Session Name: ce10_CNV_10kb_FINAL
Genome Assembly: ce10
Creation Date: 2020-05-17
Views: 1710 		1589702400 1710
Description:
Author: br1215@nyu.edu
Session Name: ce10_CNV_FINAL
Genome Assembly: ce10
Creation Date: 2020-05-17
Views: 1665 		1589702400 1665
Description:
Author: m1kss
Session Name: mouse chr16 methylation embryonic
Genome Assembly: mm10
Creation Date: 2020-05-13
Views: 1677 		1589356800 1677
Description:
Author: yael porat
Session Name: myc
Genome Assembly: hg38
Creation Date: 2020-05-10
Views: 1639 		1589097600 1639
Description: RNA plus-sense secondary structure prediction by Rangan et al are displayed. Both MEA secondary structured and MSA conserved sequences are formatted as separate tracks. All instances of "CUAAAC" motifs are annotated (plus-sense purple, negative-sense teal, complement GUUUAG) Yellow highlights represent hypothesized negative or complement interactions. Orange highlights represent non-canonical template switching overlapping with regions with high confidence secondary structure predictions. Blue highlights represent canonical TRS-L TRS-B template switching.
Author: jssim
Session Name: wuhCor
Genome Assembly: wuhCor1
Creation Date: 2020-04-23
Views: 1787 		1587628800 1787
Description:
Author: apacis
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2020-05-06
Views: 2210 		1588752000 2210
Description:
Author: Annaneed
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2020-07-06
Views: 1593 		1594022400 1593
Description:
Author: tsvid
Session Name: hg19_hemoglobin
Genome Assembly: hg19
Creation Date: 2021-09-27
Views: 1113 		1632729600 1113
Description:
Author: aoludipe
Session Name: hg19_kishimoto 1998
Genome Assembly: hg19
Creation Date: 2021-09-27
Views: 1437 		1632729600 1437
Description: All patient isolates in PRJNA613958, with exception of MinION sequenced, were individually aligned against the NC_045512.2 reference with SNPs called for each isolate using 'ngskit4b kalign'. A matrix of all individual isolate SNP site loci (rows) and isolate base calls at that loci (cols) created with 'ngskit4b snpmarkers' and this matrix then processed with 'ngskit4b snps2pgsnps' to output the pgSNPs tracks. Tracks show, for each SNP loci, the number of isolates containing the displayed allele base. Difference in tracks results from strictness of parameterisations (Allelic PValue, read coverage) used when calling SNPs.
Author: biodiscovery
Session Name: wuhCor1 PRJNA613958 allele union
Genome Assembly: wuhCor1
Creation Date: 2020-04-26
Views: 1801 		1587888000 1801
Description:
Author: tmitchell1
Session Name: SNCG with EXON2 CT and CHB and SK-N-MC
Genome Assembly: hg38
Creation Date: 2020-04-15
Views: 1605 		1586937600 1605
Description:
Author: tmitchell1
Session Name: SNCB CT with CHB and SK-N-MC
Genome Assembly: hg38
Creation Date: 2020-04-15
Views: 2014 		1586937600 2014
Description:
Author: tmitchell1
Session Name: SNCG CT with CHB and SK-N-MC
Genome Assembly: hg38
Creation Date: 2020-04-15
Views: 1735 		1586937600 1735
Description:
Author: ssdhar
Session Name: hg19 new H3k27 ac Her3
Genome Assembly: hg19
Creation Date: 2021-08-16
Views: 1299 		1629100800 1299
Description:
Author: kianayaghoobian
Session Name: CRISPR
Genome Assembly: hg38
Creation Date: 2020-09-28
Views: 1472 		1601280000 1472
Description:
Author: tmitchell
Session Name: WT and mutant on CFTR
Genome Assembly: mm9
Creation Date: 2020-04-03
Views: 1742 		1585900800 1742
Description:
Author: tmitchell
Session Name: WT and Mutant on Guca1b
Genome Assembly: mm9
Creation Date: 2020-04-03
Views: 1562 		1585900800 1562
Description:
Author: tmitchell
Session Name: WT and mutant on Guca1a
Genome Assembly: mm9
Creation Date: 2020-04-03
Views: 1779 		1585900800 1779
Description:
Author: tmitchell
Session Name: WT and Mutant CRX
Genome Assembly: mm9
Creation Date: 2020-04-03
Views: 1609 		1585900800 1609
Description:
Author: tmitchell
Session Name: MAPT mutation custom track
Genome Assembly: hg38
Creation Date: 2020-04-03
Views: 1631 		1585900800 1631
Description:
Author: tmitchell
Session Name: Exonic seq Custom Track
Genome Assembly: hg19
Creation Date: 2020-04-03
Views: 1653 		1585900800 1653
Description:
Author: liaohy
Session Name: RNAseq_Xia.L_Control_Cex
Genome Assembly: hg19
Creation Date: 2020-04-01
Views: 1723 		1585728000 1723
Description:
Author: liaohy
Session Name: RNAseq_Lin.XT_AM20191204
Genome Assembly: hg38
Creation Date: 2020-04-01
Views: 1793 		1585728000 1793
Description:
Author: Genomedx
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2020-04-09
Views: 2090 		1586419200 2090
Description:
Author: tmitchell
Session Name: WT and Mutant Arr3
Genome Assembly: mm9
Creation Date: 2020-04-03
Views: 1603 		1585900800 1603
Description:
Author: andre2tj
Session Name: 3/31_Lab_Assignment_1
Genome Assembly: hg19
Creation Date: 2020-03-31
Views: 1840 		1585641600 1840
Description:
Author: liaohy
Session Name: RNAseq_Lian.JB_AM20200311-01
Genome Assembly: hg38
Creation Date: 2020-03-30
Views: 1727 		1585555200 1727
Description: CAR-T CUT&Tag
Author: Sonja
Session Name: share_i0r9shN7
Genome Assembly: hg38
Creation Date: 2026-08-07
Views: 10 		1786089600 10
Description:
Author: sajjeev
Session Name: ICR_CMYC_optimization_03262020
Genome Assembly: hg19
Creation Date: 2020-03-26
Views: 1875 		1585209600 1875
Description: Hippo-YAP signaling controls lineage differentiation of mouse embryonic stem cells through modulating the formation of super-enhancers
Author: ZJRen
Session Name: Yap_RNAseq_part1
Genome Assembly: mm10
Creation Date: 2020-03-25
Views: 844 		1585123200 844
Description: Hippo-YAP signaling controls lineage differentiation of mouse embryonic stem cells through modulating the formation of super-enhancers
Author: ZJRen
Session Name: Yap_ChIPseq_part2
Genome Assembly: mm10
Creation Date: 2020-03-25
Views: 857 		1585123200 857
Description: Hippo-YAP signaling controls lineage differentiation of mouse embryonic stem cells through modulating the formation of super-enhancers
Author: ZJRen
Session Name: Yap_ChIPseq_part1
Genome Assembly: mm10
Creation Date: 2020-03-25
Views: 885 		1585123200 885
Description:
Author: ChPreuss
Session Name: MODEL_AD_NONCODING_VARIANTS_PRIORITIZATION
Genome Assembly: hg19
Creation Date: 2020-03-24
Views: 1795 		1585036800 1795
Description: ReMap 2020: An atlas of regulatory regions from an integrative analysis of Human and Arabidopsis thaliana DNA-binding sequencing experiments. Go to <a href="http://remap.univ-amu.fr">ReMap</a> for more info.
Author: Benoit Ballester
Session Name: US_ReMap2020_hg38
Genome Assembly: hg38
Creation Date: 2019-08-28
Views: 4621 		1566979200 4621
Description: METTL3 gene on human assembly hg38, showing a gene transcribed from the negative, or lower strand. You can see the exon numbering if you mouse over the exons on either end of the gene. The 5-end of the gene is on the right. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg38_revStrandGene
Genome Assembly: hg38
Creation Date: 2022-05-31
Views: 1018 		1653984000 1018
Description:
Author: fengtao-cau
Session Name: susScr11
Genome Assembly: susScr11
Creation Date: 2020-03-10
Views: 1828 		1583827200 1828
Description:
Author: apodgorny
Session Name: RNA_Seq
Genome Assembly: hg38
Creation Date: 2021-08-04
Views: 1242 		1628064000 1242
Description: “Spliced ESTs” data track set to pack showing varying gene arrangements for the FGFR2 gene. Each EST is labeled with the corresponding tag to the left of its sequence. CN402795 sequence read is missing exon 6 for the FGFR2 gene (yellow highlight). In the orange highlighted region, we can see two more splice variants BE706533 and BE147547 missing exon 7. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: fgfr2_highlights
Genome Assembly: hg19
Creation Date: 2022-02-28
Views: 938 		1646035200 938
Description:
Author: jeramiahsmith
Session Name: JS_structure_02262020
Genome Assembly: hub_1106737_Amex_PQ.v4
Creation Date: 2020-02-26
Views: 1580 		1582704000 1580
Description:
Author: celiagonzalez98
Session Name: Team Work 2
Genome Assembly: hg19
Creation Date: 2020-02-24
Views: 1783 		1582531200 1783
Description:
Author: celiagonzalez98
Session Name: Team Work
Genome Assembly: hg38
Creation Date: 2020-02-24
Views: 1659 		1582531200 1659
Description:
Author: Fu Haifeng
Session Name: Primed VS Naive
Genome Assembly: mm10
Creation Date: 2020-02-21
Views: 1662 		1582272000 1662
Description:
Author: chend8
Session Name: ATAC_150_intergenic_5
Genome Assembly: dm6
Creation Date: 2020-02-19
Views: 2049 		1582099200 2049
Description:
Author: vinayswamy
Session Name: DNTX
Genome Assembly: hg38
Creation Date: 2020-02-17
Views: 1824 		1581926400 1824
Description:
Author: Tamira
Session Name: Mouse ECR
Genome Assembly: hg19
Creation Date: 2020-02-17
Views: 1863 		1581926400 1863
Description:
Author: gaguil17
Session Name: Intersection.
Genome Assembly: mm10
Creation Date: 2020-02-16
Views: 1669 		1581840000 1669
Description:
Author: celiagonzalez98
Session Name: class 4 part 2
Genome Assembly: hg19
Creation Date: 2020-02-13
Views: 1930 		1581580800 1930
Description:
Author: celiagonzalez98
Session Name: class 4 part 1
Genome Assembly: hg19
Creation Date: 2020-02-13
Views: 1941 		1581580800 1941
Description:
Author: UxueHuarte
Session Name: my sesion
Genome Assembly: hg19
Creation Date: 2020-02-13
Views: 1640 		1581580800 1640
Description:
Author: dmr2928
Session Name: Daniel Robertson
Genome Assembly: mm10
Creation Date: 2020-02-12
Views: 1713 		1581494400 1713
Description:
Author: AdrianFer
Session Name: Intersected_Updated
Genome Assembly: mm10
Creation Date: 2020-02-12
Views: 1778 		1581494400 1778
Description:
Author: gaguil17
Session Name: Fgf17
Genome Assembly: mm10
Creation Date: 2020-02-12
Views: 2042 		1581494400 2042
Description:
Author: ManteoAndrade
Session Name: bejeranofoxp2
Genome Assembly: hg19
Creation Date: 2020-02-12
Views: 1680 		1581494400 1680
Description:
Author: celiagonzalez98
Session Name: class 3 part 2
Genome Assembly: hg19
Creation Date: 2020-02-12
Views: 1651 		1581494400 1651
Description:
Author: celiagonzalez98
Session Name: class 2 enviar
Genome Assembly: hg38
Creation Date: 2020-02-11
Views: 1942 		1581408000 1942
Description:
Author: mecay.1
Session Name: Session 2 final
Genome Assembly: hg38
Creation Date: 2020-02-11
Views: 1738 		1581408000 1738
Description:
Author: JonMatas
Session Name: GenoPractice 2 Public
Genome Assembly: hg38
Creation Date: 2020-02-11
Views: 1902 		1581408000 1902
Description: Juniata Bioinformatics Infantile Parkinsonism – dystonia is the second most popular neurodegenerative disorder. It is followed by Alzheimer. This disease is present in infancy and prevent those affected to live past their teenage year. This disease is fatal and has a second name known as Transporter deficiency Syndrome (DTDS). Those individuals that are affected may have many problem; limb dyskinesia, dystonia, and chorea, (OMIM,1). Currently we do not have an effective treatment to treat Infantile Parkinsonism-dystonia. This genetic mutation shows an increase between HVA and 5-HIAA in the cerebrospinal fluid. This leads to an increase in dopamine to serotonin metabolites, (OMIN,1).
Author: mmendez
Session Name: Juniata Bioinformatics; MM & NP
Genome Assembly: hg19
Creation Date: 2020-02-10
Views: 1367 		1581321600 1367
Description: Set of publicly available tracks to define enhance regions used in the human left ventricle. Accompanies Gacita et al, 2020.
Author: agacita
Session Name: Gacita_et_al_LV_Enhancer_Tracks
Genome Assembly: hg19
Creation Date: 2020-02-10
Views: 2627 		1581321600 2627
Description:
Author: Andy20UNAV
Session Name: SESION2
Genome Assembly: hg38
Creation Date: 2020-02-11
Views: 1995 		1581408000 1995
Description:
Author: irish
Session Name: Example_Diana_gtfassemblyW1_w2
Genome Assembly: hg38
Creation Date: 2020-02-10
Views: 2598 		1581321600 2598
Description: Juniata Bioinformatics BMKJ The original encoded protein functions as a transcriptional coactivator that increases c-Myc activity and inhibits transforming growth factor-beta (TGF-beta) and nuclear factor kappa-B (NF-kB) signaling. The encoded protein also regulates the stability of cyclin D1 mRNA and may play a role in cell proliferation and cancer progression. There is only one novel variant of this gene, and it is GLU366GLY. In the Puffenberger paper, they used a tool called PolyPhen-2, which can be found on Harvard's website, said the substitution was "probably damaging" with a score of 0.99. Some common characteristics expressed from the mutation are psychomotor delay, intractable seizures/epilepsy, bulbous nose, wide mouth and tongue, broad jaw, short hands, short tapered fingers, and broad thumbs. The first track pictured below shows a graph that serves as a basis for the predicted alternative splicing transcripts shown in the SIB Genes track. The blocks represent exons and the lines indicate introns. Also, there is a vertex for each splice, start, and end. The graph under the previous track shows the relationship between genetic variation and gene expression in multiple human tissues.
Author: bmiller913
Session Name: SNIP1 BMKJ
Genome Assembly: hg19
Creation Date: 2020-02-09
Views: 1695 		1581235200 1695
Description: Children with Usher’s syndrome show no problems during infancy but begin to lose their ability to hear and see during childhood. Patients also present with mild lower body abnormalities. Charles Bonnet syndrome may also occur after affected children contract an infectious illness. Charles Bonnet syndrome is characterized by “decreased visual acuity and vivid visual hallucinations.” Usher’s syndrome is caused by a missense mutation on the 454 position of the Histidyl-tRNA synthetase (HARS) gene in which a tyrosine is replaced with an serine. The normal function of HARS is to charge tRNA with a histidine amino acid. Evidence suggests that the mutation that causes Usher’s syndrome may change the recognition of tRNA codons and/or catalytic activity. The Conservation track shows that this region is conserved across several species, and has amino acid variation in two of these species: Zebrafish (M instead of Y) and Lamprey (V instead of Y). Conservation across a number of species suggests that this region is essential to many vertebrates, and is perhaps why a mutation of this region is so detrimental. The CRISPR targets track shows DNA sequences that are targetable by CRISPR RNA guides. This track is able to show an estimate of how efficient the cleavage would be at the site (Green is the highest) as well as how specific the 20-mer primer is to a specific site in the genome (Black is least specific to just that site). This could be helpful when exploring options for gene therapy or modifications to the gene. The ClinVar Variants track shows the positions of variants in the ClinVar database. This track comes with two subtracks: one for long variants (100 bp or more, most of which are copy number variants) and one for short variants (less than 100 bp). The short variant track color codes variants according to their pathogenicity. Pathogenic variants are colored red, benign variants are colored green, and variants of uncertain significance are colored gray. The long variant track color code variants according to whether the variant is a copy number gain or loss. A user can click on a variant to find more information about the variant including a report that contains an interpretation of the variant and peer reviewed citations.
Author: behreka20
Session Name: Juniata Bioinformatics KB, LL, CM
Genome Assembly: hg19
Creation Date: 2020-02-09
Views: 1719 		1581235200 1719
Description: The tracks in the Synonymous Constraint Public Hub represent regions of protein-coding sequences in which the rate of synonymous substitutions during mammalian evolution has been significantly lower or higher than in the rest of that gene. There are two tracks: Synonymous Constraint Elements (SCEs) have had lower than normal synonymous substitution rates while Synonymous Acceleration Elements (SAEs) have had higher than normal rates. Thanks to Maxim Wolf, Irwin Jungreis and others at MIT for the hub.
Author: PublicSessions
Session Name: SynonymousConstraintHub
Genome Assembly: hg19
Creation Date: 2020-02-07
Views: 1974 		1581062400 1974
Description: Various mutations of the gene TUBGCP6 lead to alterations in the amino acid sequence of the subsequent protein, which leads to potential loss-of-function of the protein. This presents pathologically with ubiquitous marked microcephaly, a receding forehead, diminutive anterior fontanelle, and sutural ridging, in addition to other varied symptoms such as cognitive impairment, reduced cranial circumference, and epilepsy.
Author: cadeemlet
Session Name: Juniata Bioinformatics CE & SA
Genome Assembly: hg19
Creation Date: 2020-02-07
Views: 1446 		1581062400 1446
Description: Juniata Bioinformatics SA and CE. Various mutations in gene TUBGCP6 result in microcephaly and chorioretinopathy. This gene codes for a protein that is part of the gamma tubulin complex, which is required for microtubule nucleation at the centrosome, and thus mitosis beginning with interphase. Mutations affecting this protein can lead to symptoms of a receding forehead, diminutive anterior fontanelle, sutural ridging, cognitive delay, visual impairment, diffuse pachygyria, and a hypoplastic cerebellar vermis. SA track: ENCODE Proteogenomics- this track is used to show functional elements of the human genome by using mass spectrometry to determine if translation is occurring by measuring protein produced by transcripts via proteogenomic mapping. This track identifies one exon within the TUBGCP6 gene. It is near the end of the mapped gene and its name is LGAGQTPGELLNPLVLNSVLSK. CE track: GTEx RNA-seq- Displayed also is track for GTEx Gene, which displays the relative gene expression through total mRNA counts of TUBGCP6 in 53 tissue sites distributed throughout the body. What can be derived primarily through this track is that the tissues which exhibit the greatest effects of TUBGCP6 gene mutations also exhibit the highest levels of genetic expression of the gene in healthy individuals, indicating a more prominent role in affected regions.
Author: slca1991
Session Name: Juniata Bioinformatics SA and CE
Genome Assembly: hg19
Creation Date: 2020-02-07
Views: 1678 		1581062400 1678
Description:
Author: prfreire
Session Name: MOLM13 MEIS1 pull down
Genome Assembly: hg19
Creation Date: 2019-09-11
Views: 1142 		1568188800 1142
Description:
Author: ignaciogoyache
Session Name: dia5
Genome Assembly: hg38
Creation Date: 2020-02-14
Views: 1958 		1581667200 1958
Description:
Author: Joseph
Session Name: ICH_rat
Genome Assembly: hg38
Creation Date: 2020-02-03
Views: 1687 		1580716800 1687
Description:
Author: philip.tatman
Session Name: sacCer3RepTimingForReview
Genome Assembly: sacCer3
Creation Date: 2020-01-31
Views: 1694 		1580457600 1694
Description:
Author: philip.tatman
Session Name: sacCer3CDKByPassForReview
Genome Assembly: sacCer3
Creation Date: 2020-01-31
Views: 1654 		1580457600 1654
Description:
Author: dramirez
Session Name: NomLeu3PROseq1st
Genome Assembly: nomLeu3
Creation Date: 2020-04-22
Views: 1782 		1587542400 1782
Description: The nucleosome sequencing data of mouse brain NAC cells from NCBI GEO archive accession GSE54263. The sequence alignment (mm9) coverage profiles (bigWig) of control, stress-susceptible and stress-resilient mice and the nucleosome occupancy change and shift events (BED) are shown.
Author: Erinija
Session Name: mouse NAC nucleosome events (mm9)
Genome Assembly: mm9
Creation Date: 2020-01-27
Views: 2071 		1580112000 2071
Description:
Author: philip.tatman
Session Name: hg38NocReleaseForReview
Genome Assembly: hg38
Creation Date: 2020-01-31
Views: 1641 		1580457600 1641
Description: The disease of interest is Infantile Parkinsonism found on the SLC6A3 gene as the variant IVS9+1G>T. Infantile Parkinsonism is described as is an extremely rare inherited neurological syndrome that presents in early infancy with hypo-kinetic Parkinsonism and dystonia that can lead to fatality. Parkinsonism is a condition that causes movement abnormalities seen in Parkinson's disease such as tremors, slow movement, and impaired speech or muscle stiffness due to he loss of dopamine-containing neurons. Dystonia is a movement disorder in which a person's muscles contract uncontrollably. The SCL6A3 gene provides instruction for making proteins, specifically a dopamine transporter. This protein is found in neurons and is responsible for the transport of dopamine into the cells. Dopamine is a chemical messenger that signals for motivation, behavior, and control movement. The variant changes the first nucleotide of the ninth intron from a G to a T. This mutation would result in a change of the splicing pattern of the DNA. The track that Nicci explored was the CRISPR Targets track which shows the DNA sequences targetable by CRISPR RNA guides using the enzyme Cas9 over the whole human genome. CRISPR technology is a simple yet powerful tool for editing genomes. It allows researchers to easily alter DNA sequences and modify gene function. The track shows all potential -NGG target sites across the genome. Gray or black regions indicate impossible or hard to target areas. The colors blue, red, yellow, and green indicate the predicted chance of cleavage from unable to calculate to high predicted cleavage respectively. Mel explored the Vega Genes track which shows gene annotations from the Vertebrate Genome Annotation (Vega) database. Annotations are divided into two sub tracks from the Vega Human Genome Annotation project. The Two sub tracks include Vega protein coding and noncoding gene annotations as well as Vega annotated pseudogenes and immunoglobulin segments. This track follows the display conventions for gene prediction tracks. Transcript type may be found by clicking on the transcript identifier which forms the outside link to the Vega link detail page. School: Juniata College
Author: NMP94876
Session Name: Homewrok 3 Nicole Piccioni and Mell ended Juanita College Bioinformatics
Genome Assembly: hg19
Creation Date: 2020-02-29
Views: 1608 		1582963200 1608
Description:
Author: keconne
Session Name: TAS2R38 group#5
Genome Assembly: hg19
Creation Date: 2020-01-21
Views: 1478 		1579593600 1478
Description:
Author: nguye5vx
Session Name: Spring 2020 TAS Test VN
Genome Assembly: hg19
Creation Date: 2020-01-21
Views: 1579 		1579593600 1579
Description:
Author: dschmelt
Session Name: Han_Chinese_LCT_Gene
Genome Assembly: hub_1969921_GCA_002180035.3_HG00514_prelim_3.0
Creation Date: 2020-01-20
Views: 1910 		1579507200 1910
Description:
Author: keough
Session Name: monkey_guides
Genome Assembly: chlSab2
Creation Date: 2020-06-30
Views: 1209 		1593504000 1209
Description:
Author: Maksimov_Denis
Session Name: ChromHMM_clusters
Genome Assembly: hg19
Creation Date: 2021-05-11
Views: 1139 		1620720000 1139
Description:
Author: swttalyan
Session Name: mm10
Genome Assembly: mm10
Creation Date: 2020-02-20
Views: 1666 		1582185600 1666
Description:
Author: ilasa.5
Session Name: Day 3 group 5
Genome Assembly: hg19
Creation Date: 2020-02-12
Views: 1733 		1581494400 1733
Description:
Author: ManteoAndrade
Session Name: foxp2
Genome Assembly: hg19
Creation Date: 2020-02-12
Views: 1639 		1581494400 1639
Description:
Author: keconne
Session Name: CGEMS yeast KEC test
Genome Assembly: sacCer3
Creation Date: 2020-01-15
Views: 1655 		1579075200 1655
Description:
Author: tmitchell
Session Name: Spring 2020 yeast test TM
Genome Assembly: sacCer3
Creation Date: 2020-01-15
Views: 1610 		1579075200 1610
Description:
Author: marti4sm
Session Name: Fall19 Yeast test SM
Genome Assembly: sacCer3
Creation Date: 2020-01-15
Views: 2021 		1579075200 2021
Description: This was an example of a CyVerse hosted assembly hub at the PAG 2020 workshop. The data at CyVerse is hosted at this directory that you can click and see the files: <a href="https://data.cyverse.org/dav-anon/iplant/home/brianleesoe/AssemblyHub_Ex1/">https://data.cyverse.org/dav-anon/iplant/home/brianleesoe/AssemblyHub_Ex1/</a>. In that directory you can click and read the text file named <a href="https://data.cyverse.org/dav-anon/iplant/home/brianleesoe/AssemblyHub_Ex1/hub.txt">hub.txt</a> and see how an assembly hub is a few stanzas that define the names of a genome and where to find binary-indexed raw data to display on the browser. The data is defined by the <code>twoBitPath araTha1.2bit</code> line in the genome stanza and in the <code>bigDataUrl cytoBandIdeo.bigBed</code> and <code>bigDataUrl ensGene.araTha1.bb</code> lines in the track stanzas. There is also an index file on the genes track <code>searchTrix ensGene.araTha1.ix</code> that allows to search the genes by both their names, such as <b> abcc2 </b>and their accessions, such as <b>AT3G50470.1</b>.
Author: brianlee
Session Name: CyVerse_Assembly_Hub
Genome Assembly: hub_1979095_araTha1
Creation Date: 2020-01-13
Views: 1650 		1578902400 1650
Description: This session reflects a PAG 2020 Sunday Session, Genomics of Non-Classical Model Animals, and a speaker Bridgett vonHoldt from Princeton University. The title of Dr. vonHoldt's talk was <b>Everyone Is Your Friend! the Molecular Architecture of Hypersocial Canines</b>. Dr. vonHoldt analyzed wolf and dog populations and discovered a 5-Mb genomic region on chromosome 6 in dogs previously found to be under positive selection in domestic dog breeding. They gathered data on friendliness between a captive wolf and pet dog populations and then examined variants. The region affected by structural variants associated with the exuberant sociability of domestic dogs related to a gene WBSCR17 on chr7 in humans linked to Williams-Beuren syndrome (WBS), a multisystem congenital disorder characterized by hypersocial behavior. Humans with this mutation have a lack of stranger danger and are overly cheerful. This session shows the WBSCR17 gene in human.
Author: brianlee
Session Name: Human_WBSCR17
Genome Assembly: hg38
Creation Date: 2020-01-13
Views: 1709 		1578902400 1709
Description: This session reflects a PAG 2020 Sunday Session, Genomics of Non-Classical Model Animals, and a speaker Claudio V. Mello from Oregon Health and Science University. Dr. Mello's talk was titled <b>What Comparative Studies of Parrot Genomes Can Teach Us about Longevity, Large Brains and Cognition</b>. Dr. Mello identified genomic features under selection in parrots and other long-lived birds that included telomerase activity (TERT), DNA damage repair, control of cell proliferation, cancer, immunity, and anti-oxidative mechanisms. His group also identified many brain-expressed, parrot-specific paralogs with known functions in neural development or vocal-learning brain circuits seen in humans (AUS2). This session shows similar alignment information in the conservation track around human AUTS2 as in one of Dr. Mello’s supplemental slides.
Author: brianlee
Session Name: Human_AUTS2
Genome Assembly: hg38
Creation Date: 2020-01-13
Views: 1891 		1578902400 1891
Description: This session reflects a PAG 2020 Poster by Hao Meng et al. from Peking-Tsinghua Center for Life Sciences, Peking University. The title of the poster was <b>Morphology and Genetics of Kinked Tails of Domestic Cats (Felis catus) in East and Southeast Asia</b>. Hao Meng and colleagues investigated the morphology and genetics of kinked tails in cats. Mutations in coding sequences (CDS) of T and HES7 were identified correlated to the short tails in Manx and Japanese bobtail breeds as well as some feral cats in Asia, However, about one third of short-tailed cats in China do not carry either variant. The poster described a new 1.6 Mb region with non-synonymous mutations were seen, suggesting changes in regulatory regions, the poster concluded. An example of viewing this region on the UCSC Browser with the regulatory Gene Interactions track turned on. In humans the interactions track seem to suggest this region has many long distant interactions spanning across it from distant enhancers.
Author: brianlee
Session Name: Human_HES7
Genome Assembly: hg38
Creation Date: 2020-01-13
Views: 1726 		1578902400 1726
Description: This session reflects a PAG 2020 Saturday Session, Cattle/Sheep/Goat 1, and the speaker George E. Liu from the Animal Genomics and Improvement Laboratory, USDA-ARS. The session title was <b>Comparative Epigenomics and Genotype-Phenotype Association Analyses Revealed Conserved Genetic Architecture underlying Complex Traits between Cattle and Human</b>. Dr. Liu’s lab examined comparative genomics around the histone marks and found that they could transfer cell-type-specific information from the human data to infer similar issues about genes related to certain diseases. A specific example was PIK3CG, a gene high specifically expressed in mononuclear cells was significantly associated with both age-at-menopause in human and daugter-still-birth in cattle. This session shows PIK3CG in human.
Author: brianlee
Session Name: Human_PIK3CG
Genome Assembly: hg38
Creation Date: 2020-01-13
Views: 1766 		1578902400 1766
Description:
Author: ManteoAndrade
Session Name: mi ventana
Genome Assembly: hg38
Creation Date: 2020-02-11
Views: 2043 		1581408000 2043
Description:
Author: nguye5vx
Session Name: Fall19 Yeast Test VN
Genome Assembly: sacCer3
Creation Date: 2020-01-19
Views: 1786 		1579420800 1786
Description:
Author: agacita
Session Name: enhancer_dominic
Genome Assembly: hg19
Creation Date: 2020-01-03
Views: 1731 		1578038400 1731
Description:
Author: saadiak2
Session Name: MS
Genome Assembly: mm9
Creation Date: 2019-12-19
Views: 1745 		1576742400 1745
Description:
Author: celiagonzalez98
Session Name: class 2
Genome Assembly: hg38
Creation Date: 2020-02-11
Views: 1978 		1581408000 1978
Description:
Author: mecay.1
Session Name: session 2
Genome Assembly: hg38
Creation Date: 2020-02-11
Views: 1930 		1581408000 1930
Description: ATAC-seq of exocrine epithelial stem cells
Author: woaichixiangcai
Session Name: Exocrine_ATAC
Genome Assembly: mm10
Creation Date: 2024-06-29
Views: 338 		1719648000 338
Description:
Author: katerynamarku
Session Name: TAS2R38
Genome Assembly: hg19
Creation Date: 2022-02-01
Views: 843 		1643702400 843
Description:
Author: JonMatas
Session Name: Geno3 G4
Genome Assembly: hg19
Creation Date: 2020-02-12
Views: 2016 		1581494400 2016
Description:
Author: egrossi
Session Name: Hi-C BAF47
Genome Assembly: hg18
Creation Date: 2019-11-29
Views: 1913 		1575014400 1913
Description: In this specific session of 3 bases with scores missing, at the very end of chrM of mm10, you can see data is lacking from all the related sources (yellow highlight): http://genome.ucsc.edu/s/brianlee/mm10_chrM This explains how there can be a discrepancy between the number of positions covered by the phastCons file and the length of a chromosome. It is likely caused by gaps in the multiple alignment process. Gaps often result from gaps in the reference assembly or variable regions that do not align well between species. Anywhere the multiple alignment is lacking data, phastCons cannot be used to calculated conservation scores.
Author: brianlee
Session Name: mm10_chrM
Genome Assembly: mm10
Creation Date: 2019-11-22
Views: 2263 		1574409600 2263
Description: Juniata Bioinformatics KH JL Lethal neonatal rigidity and multifocal seizure syndrome is characterized by underdeveloped brains and seizures that begin in-utero. Seizures continue after birth and result in death which occurs usually by the age of 4 months. The disease is caused by an insertion of an A in the BRAT1 gene. The normal BRAT1 gene function is to be a master controller of cell cycled checkpoint signaling pathways that are required for cellular responses to DNA damage.
Author: herrkx18
Session Name: Amish Lethal Neonatal rigidity and Seizure syndrome
Genome Assembly: hg19
Creation Date: 2020-02-10
Views: 1581 		1581321600 1581
Description:
Author: tacazares
Session Name: maxATAC ATAC-seq Data
Genome Assembly: hg38
Creation Date: 2022-04-11
Views: 832 		1649664000 832
Description:
Author: Erinija
Session Name: NA12878 WES Benchmark
Genome Assembly: hg19
Creation Date: 2019-11-28
Views: 2854 		1574928000 2854
Description:
Author: mia_21
Session Name: mitochonrial cyb mutation
Genome Assembly: hg38
Creation Date: 2019-10-31
Views: 1708 		1572508800 1708
Description:
Author: Brigitte
Session Name: snp hla vph
Genome Assembly: hg38
Creation Date: 2019-10-24
Views: 1669 		1571904000 1669
Description:
Author: cocopow
Session Name: hg38_genes24336
Genome Assembly: hg38
Creation Date: 2019-10-23
Views: 2366 		1571817600 2366
Description:
Author: cocopow
Session Name: hg19_LINC00299
Genome Assembly: hg19
Creation Date: 2019-10-25
Views: 1751 		1571990400 1751
Description:
Author: sguc
Session Name: miR-122_KO_genotyping_primers
Genome Assembly: mm10
Creation Date: 2019-10-17
Views: 1795 		1571299200 1795
Description:
Author: ani_davis
Session Name: TAS2R38 group6
Genome Assembly: hg19
Creation Date: 2022-02-01
Views: 827 		1643702400 827
Description:
Author: zhangh357
Session Name: hg19_m6A_site
Genome Assembly: hg19
Creation Date: 2019-10-14
Views: 1921 		1571040000 1921
Description:
Author: cocopow
Session Name: dm6_transcripts
Genome Assembly: dm6
Creation Date: 2019-10-09
Views: 1759 		1570608000 1759
Description:
Author: ykumar84
Session Name: mm10_CRE
Genome Assembly: mm10
Creation Date: 2019-10-07
Views: 1826 		1570435200 1826
Description:
Author: ykumar84
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2019-10-04
Views: 2012 		1570176000 2012
Description:
Author: mecay.1
Session Name: session 1
Genome Assembly: hg38
Creation Date: 2020-02-10
Views: 1878 		1581321600 1878
Description:
Author: cocopow
Session Name: hg38_ENCreg
Genome Assembly: hg38
Creation Date: 2019-10-03
Views: 1743 		1570089600 1743
Description:
Author: cocopow
Session Name: hg38_hg19lo_24241C
Genome Assembly: hg38
Creation Date: 2019-10-02
Views: 2096 		1570003200 2096
Description:
Author: cocopow
Session Name: hg38_hg19lo_24241B
Genome Assembly: hg38
Creation Date: 2019-10-02
Views: 1963 		1570003200 1963
Description:
Author: cocopow
Session Name: hg38_hg19lo_24241A
Genome Assembly: hg38
Creation Date: 2019-10-02
Views: 1829 		1570003200 1829
Description:
Author: sallen
Session Name: DSP-hg38
Genome Assembly: hg38
Creation Date: 2020-02-11
Views: 1699 		1581408000 1699
Description:
Author: rgmilian
Session Name: hg19_BamHIsite
Genome Assembly: hg19
Creation Date: 2019-09-25
Views: 935 		1569398400 935
Description:
Author: rgmilian
Session Name: hg19_20p13_exon_view_flaggedSNPs+exons
Genome Assembly: hg19
Creation Date: 2019-09-24
Views: 841 		1569312000 841
Description:
Author: barloweml
Session Name: YeastPracticeMLB
Genome Assembly: sacCer3
Creation Date: 2019-09-24
Views: 1808 		1569312000 1808
Description:
Author: ykumar84
Session Name: mm10
Genome Assembly: mm10
Creation Date: 2019-09-18
Views: 2306 		1568793600 2306
Description:
Author: IsaacGelman
Session Name: mm10_h3k4me3
Genome Assembly: mm10
Creation Date: 2019-11-01
Views: 1685 		1572595200 1685
Description:
Author: nheyer
Session Name: New_wiggles
Genome Assembly: hg38
Creation Date: 2019-11-12
Views: 1665 		1573545600 1665
Description: CircRNA annotation as identified in the publication "Evolutionarily young transposable elements drive circular RNA repertoires" by Gruhl et al. (in preparation). The browser view include an additional track with the repeat dimers surrounding the respective circRNA.
Author: Frenzchen
Session Name: hg38 circRNA annotation
Genome Assembly: hg38
Creation Date: 2019-02-10
Views: 1572 		1549785600 1572
Description: CircRNA and parental gene annotation as identified in the publication "Evolutionarily young transposable elements drive circular RNA repertoires" by Gruhl et al. (in preparation). The browser view include an additional track with the repeat dimers surrounding the respective circRNA.
Author: Frenzchen
Session Name: rn5 circRNA annotation
Genome Assembly: rn5
Creation Date: 2016-09-23
Views: 1591 		1474617600 1591
Description: CircRNA and parental gene annotation as identified in the publication "Evolutionarily young transposable elements drive circular RNA repertoires" by Gruhl et al. (in preparation). The browser view include an additional track with the repeat dimers surrounding the respective circRNA.
Author: Frenzchen
Session Name: mm10 circRNA annotation
Genome Assembly: mm10
Creation Date: 2016-09-23
Views: 1851 		1474617600 1851
Description: CircRNA and parental gene annotation as identified in the publication "Evolutionarily young transposable elements drive circular RNA repertoires" by Gruhl et al. (in preparation). The browser view include an additional track with the repeat dimers surrounding the respective circRNA.
Author: Frenzchen
Session Name: monDom5 circRNA annotation
Genome Assembly: monDom5
Creation Date: 2016-09-23
Views: 1610 		1474617600 1610
Description:
Author: MarcoDS
Session Name: B_to_PSC_reprogramming
Genome Assembly: mm10
Creation Date: 2019-09-16
Views: 1698 		1568620800 1698
Description:
Author: bethpay
Session Name: mm10_il7r_findenhancerpromoter
Genome Assembly: mm10
Creation Date: 2019-09-09
Views: 1894 		1568016000 1894
Description:
Author: rafal.czapiewski@ed.ac.uk
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2019-09-09
Views: 1578 		1568016000 1578
Screenshot not available
Click Here to view
 Description:
Author: tolvayha
Session Name: Fall18 Worm test HT
Genome Assembly: ce11
Creation Date: 2018-08-30
Views: 1874 		1535616000 1874
Screenshot not available
Click Here to view
 Description:
Author: tolvayha
Session Name: RHO - Photoreceptor
Genome Assembly: hg19
Creation Date: 2018-11-13
Views: 1815 		1542096000 1815
Description:
Author: swarnaseetha
Session Name: mm10
Genome Assembly: mm10
Creation Date: 2019-10-23
Views: 1691 		1571817600 1691
Description: ReMap 2018: An atlas of regulatory regions from an integrative analysis of Human DNA-binding sequencing experiments. Go to <a href="http://remap.univ-amu.fr">ReMap</a> for more info. <a href="https://academic.oup.com/nar/article/46/D1/D267/4602873">ReMap 2018 paper</a>.
Author: Benoit Ballester
Session Name: US_hg38_ReMap2018
Genome Assembly: hg38
Creation Date: 2017-08-11
Views: 3429 		1502438400 3429
Description:
Author: rasou2ba
Session Name: hg19 - rs12357257 - Rasoul
Genome Assembly: hg19
Creation Date: 2017-10-31
Views: 2032 		1509436800 2032
Description:
Author: pesinojv
Session Name: TAS2R38 group#4
Genome Assembly: hg19
Creation Date: 2018-01-22
Views: 1878 		1516608000 1878
Description:
Author: oshgo
Session Name: 14q32Methyl450-GO8
Genome Assembly: hg19
Creation Date: 2015-10-19
Views: 2189 		1445241600 2189
Description: GH01J209814 is an enhancer associated with the gene IRF6 (Interferon Regulatory Factor 6). Coding mutations in IRF6 are known to be pathogenic, causing diseases related to cleft lip and cleft palate, such as Van Der Woude Syndrome 1 (VWS1). GH01J209814, an enhancer of IRF6 located ~10kb upstream from the gene, harbors regulatory non-coding variants strongly associated with VWS1.
Author: simonf
Session Name: IRF6 cleft lip enhancer
Genome Assembly: hg19
Creation Date: 2018-11-28
Views: 1896 		1543392000 1896
Description:
Author: australia2018
Session Name: hg18_EP_bamSnps_custom
Genome Assembly: hg18
Creation Date: 2018-11-07
Views: 1874 		1541577600 1874
Description:
Author: rafal.czapiewski@ed.ac.uk
Session Name: BAC and FOSMID
Genome Assembly: mm10
Creation Date: 2019-03-27
Views: 1842 		1553673600 1842
Description:
Author: jazmynperez
Session Name: APP
Genome Assembly: hg19
Creation Date: 2018-11-07
Views: 2544 		1541577600 2544
Description:
Author: huijing
Session Name: check_pacbio
Genome Assembly: dm6
Creation Date: 2018-11-06
Views: 1100 		1541491200 1100
Description:
Author: cehnouz
Session Name: test1
Genome Assembly: hg19
Creation Date: 2017-08-25
Views: 2003 		1503648000 2003
Description:
Author: jtm
Session Name: shiny_app_hg38_v2
Genome Assembly: hg38
Creation Date: 2018-11-05
Views: 3113 		1541404800 3113
Description:
Author: ruhollah
Session Name: 18_chr17
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 1994 		1541059200 1994
Description:
Author: ruhollah
Session Name: 20_chr1
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 1901 		1541059200 1901
Description:
Author: ruhollah
Session Name: 14_chr2
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 2142 		1541059200 2142
Description:
Author: ruhollah
Session Name: 17_chr3
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 1922 		1541059200 1922
Description:
Author: ruhollah
Session Name: 19_chr10
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 1867 		1541059200 1867
Description:
Author: ruhollah
Session Name: 16_chr5
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 1860 		1541059200 1860
Description:
Author: ruhollah
Session Name: 6_chr11
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 1859 		1541059200 1859
Description:
Author: ruhollah
Session Name: 8_chr2
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 2171 		1541059200 2171
Description:
Author: ruhollah
Session Name: 11_chr10
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 1844 		1541059200 1844
Description:
Author: ruhollah
Session Name: 12_chr3
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 2146 		1541059200 2146
Description:
Author: ruhollah
Session Name: 13_chr3
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 1876 		1541059200 1876
Description:
Author: ruhollah
Session Name: 15_chr19
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 1798 		1541059200 1798
Description:
Author: ruhollah
Session Name: 7_chr11
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 2157 		1541059200 2157
Description:
Author: ruhollah
Session Name: 9_chr20
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 1842 		1541059200 1842
Description:
Author: ruhollah
Session Name: 5_chr16
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 1960 		1541059200 1960
Description:
Author: ruhollah
Session Name: 4_chr3
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 1835 		1541059200 1835
Description:
Author: ruhollah
Session Name: 10_chr17
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 1842 		1541059200 1842
Description:
Author: ruhollah
Session Name: 3_chr14
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 1864 		1541059200 1864
Description:
Author: ruhollah
Session Name: 2_chr8
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 1973 		1541059200 1973
Description:
Author: ruhollah
Session Name: 1_chr15
Genome Assembly: hg38
Creation Date: 2018-11-01
Views: 1782 		1541059200 1782
Description: This session highlights data from the DASHR v2.0 Hub, created by the Wang lab at the University of Pennsylvania. DASHR is a comprehensive database of expression and processing information to date on all major classes of human small non-coding RNA (sncRNA) genes and mature sncNA annotations, expression levels, sequence and RNA processing information across 185 human tissues, cell types, and cell lines. The region being visualized shows mir-132. A sncRNA linked to post-transcriptional regulation of neuronal cells. More info on DASHR V2.0: http://dashr2.lisanwanglab.org/
Author: Lou
Session Name: DASHRV2
Genome Assembly: hg38
Creation Date: 2018-12-11
Views: 2125 		1544515200 2125
Description:
Author: sharma.896
Session Name: TP53
Genome Assembly: hg19
Creation Date: 2018-10-30
Views: 2115 		1540886400 2115
Description: human p53 ChIP-seq coverage depth (tracks) & SISSRs peak calls with associated differential gene expression from published data as of May 2015
Author: cocapo
Session Name: human p53 Binding And Expression Resource (BAER) hub
Genome Assembly: hg19
Creation Date: 2018-10-30
Views: 2218 		1540886400 2218
Description:
Author: cocopow
Session Name: hg19_rn6_geneHancer
Genome Assembly: hg19
Creation Date: 2019-01-18
Views: 2061 		1547798400 2061
Description:
Author: cocopow
Session Name: hg38_GeneHancer
Genome Assembly: hg38
Creation Date: 2019-01-28
Views: 1978 		1548662400 1978
Description:
Author: apacis
Session Name: Wu_ARMC5_ChIP_C3G
Genome Assembly: mm10
Creation Date: 2020-10-08
Views: 1283 		1602144000 1283
Description: chr3_H3k27me3_8m
Author: ankurucsc
Session Name: chr3_H3k27me3_8m
Genome Assembly: mm10
Creation Date: 2021-01-28
Views: 26 		1611820800 26
Description: This sessionView is a collection of tracks centered around large genetic variants (CNVs). The session is organized with gene annotations at the top, followed by the <a href="https://academic.oup.com/nar/article/42/D1/D986/1068860" target="_blank">DGV Struct Var track</a>, which displays variants observed in healthy individuals. The rest of the tracks include different databases that visualize large variants linked to disease phenotypes. The region displayed is a 2Mbp region on chr4 with many pathological variants present.
Author: view
Session Name: VariationCNVs
Genome Assembly: hg19
Creation Date: 2018-10-16
Views: 2004 		1539676800 2004
Description: This sessionView is a collection of tracks centered around genetic variation. The collection of tracks primarily displays small variants from multiple databases. The session is organized with tracks having fewer variants with more annotations near the top, and large tracks with fewer annotations near the bottom. The region displayed is the <a href="https://ghr.nlm.nih.gov/gene/SOD1" target="_blank">SOD1 gene</a> which is well annotated and provides an exemplar for this track collection.
Author: view
Session Name: Variation
Genome Assembly: hg19
Creation Date: 2018-10-10
Views: 1896 		1539158400 1896
Description: This sessionView is a collection of tracks centered around comparative genomics. It primarily consists of multiz alignments and conserved elements/conservation scores identified by <a href="http://compgen.cshl.edu/phast/" target="_blank">phastCons</a>. 18 organisms were chosen for comparison from 100 available vertebrates, sampling clades evenly. The region displayed is an ultra-conserved region in the PCBP2 gene where little divergence is seen throughout all mammals. A similar session is available, <a href="http://genome.ucsc.edu/cgi-bin/hgTracks?hgS_doOtherUser=submit&hgS_otherUserName=view&hgS_otherUserSessionName=ConservationDiv" target="_blank">ConservationDiv</a>, which looks at a highly divergent region of the genome.
Author: view
Session Name: ConservationCons
Genome Assembly: hg19
Creation Date: 2018-10-10
Views: 2842 		1539158400 2842
Description: This sessionView is a collection of tracks centered around comparative genomics. It primarily consists of multiz alignments and conserved elements/conservation scores identified by <a href="http://compgen.cshl.edu/phast/" target="_blank">phastCons</a>. 18 organisms were chosen for comparison from 100 available vertebrates, sampling clades evenly. The region displayed is a <a href="https://www.hhmi.org/news/researchers-identify-human-dna-fast-track" target="_blank">human accelerated region (HAR)</a>. HARs are among the most divergent regions in the genome displaying high divergence even among primates. An alternate region of this session is also available, <a href="http://genome.ucsc.edu/cgi-bin/hgTracks?hgS_doOtherUser=submit&hgS_otherUserName=view&hgS_otherUserSessionName=ConservationCons" target="_blank">ConservationCons</a>, which looks at a highly conserved region of the genome.
Author: view
Session Name: ConservationDiv
Genome Assembly: hg19
Creation Date: 2018-10-10
Views: 2811 		1539158400 2811
Description: This sessionView is a collection of tracks centered around clinical significance. The track composition is similar to the <a href="http://genome.ucsc.edu/cgi-bin/hgTracks?hgS_doOtherUser=submit&hgS_otherUserName=view&hgS_otherUserSessionName=Clinical" target="_blank">Clinical</a> public session, however, the number of tracks has been reduced to increase clarity. Featured tracks include gene annotations, SNVs, CNVs, SVs, and our publications track built by mining sequences and SNPs in publications. The displayed region is focused around the HTT gene, responsible for Huntington's disease and Lopes-Maciel-Rodan syndrome. The large region, which also includes part of the adjacent GRK4 gene, showcases the more concise view of this track in contrast to the <a href="http://genome.ucsc.edu/cgi-bin/hgTracks?hgS_doOtherUser=submit&hgS_otherUserName=view&hgS_otherUserSessionName=Clinical" target="_blank">Clinical</a> session. A similar session is also available which shows the bp resolution CAG repeat linked to Huntington's disease, <a href="http://genome.ucsc.edu/cgi-bin/hgTracks?hgS_doOtherUser=submit&hgS_otherUserName=view&hgS_otherUserSessionName=ClinicalZoom" target="_blank">ClinicalZoom</a>.
Author: view
Session Name: ClinicalLite
Genome Assembly: hg19
Creation Date: 2018-10-10
Views: 3193 		1539158400 3193
Description: This sessionView is a collection of tracks centered around gene support. The region displayed includes the <a href="https://www.ncbi.nlm.nih.gov/gene /3198" target="_blank"> HOXA1</a> gene and its upstream neighbor <a href="https://www.ncbi.nlm.nih.gov/gene/100506311" target="_blank"> HOTAIRM1</a>. The view is organized with different gene annotation approaches at the top, followed by mRNA evidence, and TSS data at the bottom.
Author: view
Session Name: GeneSupport
Genome Assembly: hg19
Creation Date: 2018-10-05
Views: 3345 		1538726400 3345
Description:
Author: xingjie
Session Name: FMR1-AFF2-iPSC screening
Genome Assembly: hg38
Creation Date: 2018-10-05
Views: 2076 		1538726400 2076
Description:
Author: EsterCastillo
Session Name: VanesaGarcia_AS
Genome Assembly: hg38
Creation Date: 2018-08-14
Views: 2145 		1534233600 2145
Description:
Author: EsterCastillo
Session Name: SandraHernandez_UPF
Genome Assembly: hg38
Creation Date: 2018-12-10
Views: 1780 		1544428800 1780
Description:
Author: EsterCastillo
Session Name: NuriaSala_ICO_AS
Genome Assembly: hg19
Creation Date: 2018-06-18
Views: 1830 		1529308800 1830
Description:
Author: EsterCastillo
Session Name: NRCC_HospTxagorritxo_Guiomar
Genome Assembly: hg19
Creation Date: 2018-08-01
Views: 1871 		1533110400 1871
Description:
Author: EsterCastillo
Session Name: Meme_ROIs_AmpliSeq
Genome Assembly: hg19
Creation Date: 2018-12-18
Views: 1796 		1545120000 1796
Description:
Author: EsterCastillo
Session Name: MarcSorigue
Genome Assembly: hg19
Creation Date: 2018-08-24
Views: 2259 		1535097600 2259
Description:
Author: EsterCastillo
Session Name: LifeSequencing_JuanMartinez
Genome Assembly: hg19
Creation Date: 2018-05-18
Views: 1845 		1526630400 1845
Description:
Author: EsterCastillo
Session Name: LauraMuinelo_CHUS_AS
Genome Assembly: hg38
Creation Date: 2018-05-31
Views: 2039 		1527753600 2039
Description:
Author: EsterCastillo
Session Name: HURyC_Gloria_Francisco_25bp_padding
Genome Assembly: hg19
Creation Date: 2019-03-24
Views: 2502 		1553414400 2502
Description:
Author: EsterCastillo
Session Name: HURyC_Gloria_Francisco_10bp_padding
Genome Assembly: hg19
Creation Date: 2019-03-24
Views: 1726 		1553414400 1726
Description:
Author: EsterCastillo
Session Name: HDR_LuciaPerezCarbonero_HospBurgos_NMs
Genome Assembly: hg19
Creation Date: 2018-09-06
Views: 1826 		1536220800 1826
Description:
Author: EsterCastillo
Session Name: HDR_LuciaPerezCarbonero_HospBurgos
Genome Assembly: hg19
Creation Date: 2018-08-24
Views: 1802 		1535097600 1802
Description:
Author: EsterCastillo
Session Name: Genycell_FJD_Tcell
Genome Assembly: hg19
Creation Date: 2019-05-28
Views: 1686 		1559030400 1686
Description:
Author: EsterCastillo
Session Name: Genycell_FJD_Bcell
Genome Assembly: hg19
Creation Date: 2019-05-28
Views: 1718 		1559030400 1718
Description:
Author: EsterCastillo
Session Name: BarbaraTazon_AS_Myeloid
Genome Assembly: hg19
Creation Date: 2018-04-09
Views: 1903 		1523260800 1903
Description:
Author: EsterCastillo
Session Name: Arnau_DrViladell_AmpliSeq
Genome Assembly: hg19
Creation Date: 2019-05-08
Views: 1657 		1557302400 1657
Description:
Author: EsterCastillo
Session Name: AnaSebio_HospStPau
Genome Assembly: hg19
Creation Date: 2018-05-01
Views: 2035 		1525161600 2035
Description:
Author: EsterCastillo
Session Name: AnaOsorio_AS_CNIO
Genome Assembly: hg19
Creation Date: 2018-05-24
Views: 1902 		1527148800 1902
Description:
Author: EsterCastillo
Session Name: AmpliSeq_Meme_Concierge2
Genome Assembly: hg19
Creation Date: 2019-02-11
Views: 1760 		1549872000 1760
Description:
Author: EsterCastillo
Session Name: AmpliSeq_Meme_Concierge
Genome Assembly: hg19
Creation Date: 2019-01-31
Views: 1835 		1548921600 1835
Description:
Author: EsterCastillo
Session Name: AmpliSeq Focus
Genome Assembly: hg19
Creation Date: 2018-08-20
Views: 1789 		1534752000 1789
Description:
Author: EsterCastillo
Session Name: AmpliSeq Cancer HotSpots v2
Genome Assembly: hg19
Creation Date: 2018-06-06
Views: 1745 		1528272000 1745
Description:
Author: EsterCastillo
Session Name: 12Oct_todos37g_DLW
Genome Assembly: hg19
Creation Date: 2019-01-20
Views: 2212 		1547971200 2212
Description:
Author: tzaro
Session Name: mm9
Genome Assembly: mm9
Creation Date: 2018-10-08
Views: 2129 		1538985600 2129
Description:
Author: zheyangshan
Session Name: hg19 GRO-seq EGFR shjun
Genome Assembly: hg19
Creation Date: 2019-01-16
Views: 1659 		1547625600 1659
Description:
Author: sajjeev
Session Name: sj39_40
Genome Assembly: hg19
Creation Date: 2019-01-17
Views: 2381 		1547712000 2381
Description:
Author: cocopow
Session Name: mm10_limbs
Genome Assembly: mm10
Creation Date: 2019-01-15
Views: 1991 		1547539200 1991
Description:
Author: emmawentworth
Session Name: Adult-Mouse-Adipose
Genome Assembly: mm10
Creation Date: 2019-04-29
Views: 1807 		1556524800 1807
Description:
Author: Heywhoyou22
Session Name: AMD SNP C9 2
Genome Assembly: hg19
Creation Date: 2018-10-02
Views: 1828 		1538467200 1828
Description:
Author: brittatj
Session Name: Fall19 Yeast test(TB)
Genome Assembly: sacCer3
Creation Date: 2019-08-27
Views: 1600 		1566892800 1600
Description:
Author: Matteo
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2018-10-02
Views: 1796 		1538467200 1796
Description:
Author: cocapo
Session Name: dense2pack
Genome Assembly: hg38
Creation Date: 2018-09-26
Views: 2095 		1537948800 2095
Description:
Author: akhoke
Session Name: KMT2E/SRPK2_2
Genome Assembly: hg19
Creation Date: 2018-09-25
Views: 1977 		1537862400 1977
Description:
Author: mazawm
Session Name: hg19#19SingleNucleotideResolution
Genome Assembly: hg19
Creation Date: 2018-09-25
Views: 1631 		1537862400 1631
Description:
Author: benbeijs
Session Name: AMD SNP (JSB), CFH Exercise 2 (SNPs)
Genome Assembly: hg19
Creation Date: 2018-09-25
Views: 1913 		1537862400 1913
Description:
Author: anglemem
Session Name: AMD SNP 2
Genome Assembly: hg19
Creation Date: 2018-09-25
Views: 1953 		1537862400 1953
Description:
Author: akhoke
Session Name: KMT2E/SRPK2
Genome Assembly: hg19
Creation Date: 2018-09-25
Views: 1906 		1537862400 1906
Description:
Author: benbeijs
Session Name: AMD SNP (JSB), CFH Exercise 1
Genome Assembly: hg19
Creation Date: 2018-09-25
Views: 1941 		1537862400 1941
Description:
Author: mazawm
Session Name: hg19#19GenomicContext
Genome Assembly: hg19
Creation Date: 2018-09-25
Views: 1661 		1537862400 1661
Description:
Author: Heywhoyou22
Session Name: AMD SNP C9 zoom
Genome Assembly: hg19
Creation Date: 2018-09-25
Views: 1747 		1537862400 1747
Description:
Author: Heywhoyou22
Session Name: AMD SNP C9
Genome Assembly: hg19
Creation Date: 2018-09-25
Views: 1796 		1537862400 1796
Description:
Author: Heywhoyou22
Session Name: HGD
Genome Assembly: hg19
Creation Date: 2018-09-25
Views: 1840 		1537862400 1840
Description:
Author: mazawm
Session Name: hg19HGDmazawm2
Genome Assembly: hg19
Creation Date: 2018-09-19
Views: 1802 		1537344000 1802
Description:
Author: akhoke
Session Name: HGD2
Genome Assembly: hg19
Creation Date: 2018-09-18
Views: 1813 		1537257600 1813
Description:
Author: benbeijs
Session Name: UCSC/ApE (JSB) Exercise, Exon 10
Genome Assembly: hg19
Creation Date: 2018-09-18
Views: 1770 		1537257600 1770
Description:
Author: white4cj
Session Name: Fall 19 Yeast Test (JW, PA, MG)
Genome Assembly: sacCer3
Creation Date: 2019-08-27
Views: 1669 		1566892800 1669
Description:
Author: akhoke
Session Name: HGD
Genome Assembly: hg19
Creation Date: 2018-09-18
Views: 1822 		1537257600 1822
Description:
Author: mazawm
Session Name: hg19HGDmazawm
Genome Assembly: hg19
Creation Date: 2018-09-18
Views: 1893 		1537257600 1893
Description:
Author: anglemem
Session Name: HGD Gene (EMA)
Genome Assembly: hg19
Creation Date: 2018-09-18
Views: 1869 		1537257600 1869
Description:
Author: benbeijs
Session Name: UCSC/ApE (JSB) Exercise
Genome Assembly: hg19
Creation Date: 2018-09-18
Views: 1753 		1537257600 1753
Description:
Author: yangyangyh
Session Name: mm10
Genome Assembly: mm10
Creation Date: 2018-09-16
Views: 1799 		1537084800 1799
Description: The LCT gene, responsible for digesting lactose, and the nearby MCM6 gene, which harbors variants that affect the expression of LCT. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_LCTandMCM6
Genome Assembly: hg19
Creation Date: 2022-06-22
Views: 934 		1655884800 934
Description:
Author: dcaetan2
Session Name: mm10
Genome Assembly: mm10
Creation Date: 2017-12-05
Views: 2143 		1512460800 2143
Description:
Author: cocopow
Session Name: hg19_chrM
Genome Assembly: hg19
Creation Date: 2019-08-13
Views: 2558 		1565683200 2558
Description:
Author: ruifang
Session Name: TAC3
Genome Assembly: hg38
Creation Date: 2019-08-11
Views: 1692 		1565510400 1692
Description:
Author: cocopow
Session Name: panTro6_refSeq
Genome Assembly: panTro6
Creation Date: 2019-08-20
Views: 1704 		1566288000 1704
Description:
Author: Alexandra Despang
Session Name: PWD_SNPS_mm10
Genome Assembly: mm10
Creation Date: 2016-01-15
Views: 1626 		1452844800 1626
Description:
Author: mziegler
Session Name: encode_Accessibility _4
Genome Assembly: hg19
Creation Date: 2018-09-06
Views: 1970 		1536220800 1970
Description:
Author: mziegler
Session Name: encode_Accessibility _3
Genome Assembly: hg19
Creation Date: 2018-09-06
Views: 1971 		1536220800 1971
Description:
Author: mziegler
Session Name: encode_Accessibility _2
Genome Assembly: hg19
Creation Date: 2018-09-06
Views: 1985 		1536220800 1985
Description:
Author: mazawm
Session Name: hg19withDSPandMYBPC1
Genome Assembly: hg19
Creation Date: 2018-09-04
Views: 1826 		1536048000 1826
Description:
Author: akhoke
Session Name: hg19_9/4/18
Genome Assembly: hg19
Creation Date: 2018-09-04
Views: 1826 		1536048000 1826
Description:
Author: Heywhoyou22
Session Name: DSP
Genome Assembly: hg19
Creation Date: 2018-09-04
Views: 1929 		1536048000 1929
Description:
Author: Heywhoyou22
Session Name: MYBPC1
Genome Assembly: hg19
Creation Date: 2018-09-04
Views: 1801 		1536048000 1801
Description:
Author: zheyangshan
Session Name: hg19 BCL2
Genome Assembly: hg19
Creation Date: 2018-09-04
Views: 1718 		1536048000 1718
Description:
Author: abby.stapleton
Session Name: Spring17 Mouse Test
Genome Assembly: mm9
Creation Date: 2019-07-29
Views: 1823 		1564387200 1823
Description:
Author: abby.stapleton
Session Name: Spring17 Human Test
Genome Assembly: hg38
Creation Date: 2019-07-29
Views: 1591 		1564387200 1591
Description:
Author: abby.stapleton
Session Name: Spring17 Worm Test
Genome Assembly: ce11
Creation Date: 2019-07-29
Views: 1595 		1564387200 1595
Description:
Author: abby.stapleton
Session Name: Spring17 Yeast Test
Genome Assembly: sacCer3
Creation Date: 2019-07-29
Views: 1616 		1564387200 1616
Description:
Author: jwjiao
Session Name: PRDM16KO1_E15WT1.anno
Genome Assembly: hg38
Creation Date: 2019-08-05
Views: 1652 		1564992000 1652
Description:
Author: xgwZRyfWLidWxULv
Session Name: RPE_public
Genome Assembly: hg19
Creation Date: 2019-01-15
Views: 1682 		1547539200 1682
Description:
Author: elencampoy
Session Name: HsInv0379
Genome Assembly: hg19
Creation Date: 2021-02-25
Views: 1121 		1614240000 1121
Description:
Author: bondurlc
Session Name: TAS2R38 group 3
Genome Assembly: hg19
Creation Date: 2018-09-03
Views: 1818 		1535961600 1818
Description:
Author: ruhollah
Session Name: hg19_118Chr22_nmt4
Genome Assembly: hg19
Creation Date: 2019-01-14
Views: 1786 		1547452800 1786
Description:
Author: ruhollah
Session Name: hg19_100Chr19_nmt3
Genome Assembly: hg19
Creation Date: 2019-01-14
Views: 1740 		1547452800 1740
Description:
Author: mazawm
Session Name: mazawm/hg19
Genome Assembly: hg19
Creation Date: 2018-08-31
Views: 1803 		1535702400 1803
Description:
Author: erhuoyi
Session Name: suva
Genome Assembly: hg38
Creation Date: 2018-08-31
Views: 1894 		1535702400 1894
Description:
Author: benbeijs
Session Name: MYBPC1 (JSB) Assignment
Genome Assembly: hg19
Creation Date: 2018-08-30
Views: 2232 		1535616000 2232
Description:
Author: akhoke
Session Name: Human Genome DSP
Genome Assembly: hg19
Creation Date: 2018-08-30
Views: 1801 		1535616000 1801
Description:
Author: anglemem
Session Name: EmilyAnglemyer 8/30 In class browser assignment
Genome Assembly: hg19
Creation Date: 2018-08-30
Views: 1821 		1535616000 1821
Description:
Author: Morgan_T
Session Name: Aug30 Asignment MT
Genome Assembly: hg19
Creation Date: 2018-08-30
Views: 1804 		1535616000 1804
Description:
Author: stjacqrm
Session Name: Spring18_DSP_RMSJ
Genome Assembly: hg19
Creation Date: 2018-08-30
Views: 1929 		1535616000 1929
Description:
Author: benbeijs
Session Name: CGEMS Worm (JSB) Test
Genome Assembly: ce11
Creation Date: 2018-08-30
Views: 1875 		1535616000 1875
Description:
Author: sschuma
Session Name: Fall18 DSP (SS)
Genome Assembly: hg19
Creation Date: 2018-08-30
Views: 1775 		1535616000 1775
Description:
Author: akhoke
Session Name: Yeast AKH
Genome Assembly: sacCer3
Creation Date: 2018-08-30
Views: 2020 		1535616000 2020
Description:
Author: erick.gabriel
Session Name: ICD-1 gene (by Erick)
Genome Assembly: ce11
Creation Date: 2018-08-30
Views: 1880 		1535616000 1880
Description:
Author: mazawm
Session Name: mazawm8/30
Genome Assembly: ce11
Creation Date: 2018-08-30
Views: 1968 		1535616000 1968
Description:
Author: akhoke
Session Name: CGEMS yeast AKH test
Genome Assembly: sacCer3
Creation Date: 2018-08-30
Views: 1823 		1535616000 1823
Description:
Author: Morgan_T
Session Name: Fall18 Yeast test M.T.
Genome Assembly: sacCer3
Creation Date: 2018-08-30
Views: 1780 		1535616000 1780
Description:
Author: foxaa
Session Name: Fall18 Worm test AF
Genome Assembly: ce11
Creation Date: 2018-08-30
Views: 2378 		1535616000 2378
Description:
Author: Heywhoyou22
Session Name: Spring18 Worm test MRK
Genome Assembly: ce11
Creation Date: 2018-08-30
Views: 1790 		1535616000 1790
Description:
Author: stjacqrm
Session Name: Spring18_Yeast_test_RMSJ
Genome Assembly: sacCer3
Creation Date: 2018-08-30
Views: 2022 		1535616000 2022
Description:
Author: hammer
Session Name: piranha-eclip_sclip2
Genome Assembly: hg38
Creation Date: 2018-08-30
Views: 1937 		1535616000 1937
Description:
Author: sschuma
Session Name: Fall18 Yeast Test (SS)
Genome Assembly: sacCer3
Creation Date: 2018-08-30
Views: 1784 		1535616000 1784
Description:
Author: Heywhoyou22
Session Name: forenke2
Genome Assembly: hg38
Creation Date: 2018-11-29
Views: 1884 		1543478400 1884
Description:
Author: Heywhoyou22
Session Name: forenke
Genome Assembly: hg38
Creation Date: 2018-11-29
Views: 1826 		1543478400 1826
Description:
Author: Boonede
Session Name: TAS2R38#6
Genome Assembly: hg19
Creation Date: 2019-01-14
Views: 1663 		1547452800 1663
Description: RYiu-90010430-MEDG580-UBC-2020
Author: cpddoraemon
Session Name: RYiu-90010430-MEDG580-UBC-2020
Genome Assembly: hg38
Creation Date: 2022-10-09
Views: 692 		1665302400 692
Description:
Author: anzelm
Session Name: hg19-hrc3
Genome Assembly: hg19
Creation Date: 2018-03-19
Views: 2101 		1521446400 2101
Description:
Author: anzelm
Session Name: hg19-180-10-3
Genome Assembly: hg19
Creation Date: 2018-03-19
Views: 1857 		1521446400 1857
Description:
Author: anglemem
Session Name: MYBPC1 Anglemyer
Genome Assembly: hg19
Creation Date: 2018-09-04
Views: 1776 		1536048000 1776
Description:
Author: anglemem
Session Name: DSP
Genome Assembly: hg19
Creation Date: 2018-09-05
Views: 2228 		1536134400 2228
Description:
Author: anglemem
Session Name: 10/2 custom track assignment
Genome Assembly: hg19
Creation Date: 2018-10-02
Views: 2022 		1538467200 2022
Description:
Author: allisontaggart
Session Name: hg19_BPs
Genome Assembly: hg19
Creation Date: 2017-01-18
Views: 2346 		1484726400 2346
Description:
Author: alexc
Session Name: CytoSettings
Genome Assembly: hg19
Creation Date: 2018-03-13
Views: 2165 		1520928000 2165
Description:
Author: alexaabdelaziz
Session Name: colored_clusters_Alexa_AA
Genome Assembly: hg19
Creation Date: 2017-02-24
Views: 2129 		1487923200 2129
Description:
Author: akhoke
Session Name: MYBPC1
Genome Assembly: hg19
Creation Date: 2018-09-04
Views: 1840 		1536048000 1840
Description:
Author: akhoke
Session Name: DSP
Genome Assembly: hg19
Creation Date: 2018-09-04
Views: 1875 		1536048000 1875
Description:
Author: akhoke
Session Name: CRLs3
Genome Assembly: hg19
Creation Date: 2018-11-13
Views: 1816 		1542096000 1816
Description:
Author: akhoke
Session Name: CRLs2
Genome Assembly: hg19
Creation Date: 2018-11-13
Views: 1790 		1542096000 1790
Description:
Author: akhoke
Session Name: CRLs
Genome Assembly: hg19
Creation Date: 2018-11-13
Views: 1800 		1542096000 1800
Description:
Author: akhoke
Session Name: AMD SNP Custom Track
Genome Assembly: hg19
Creation Date: 2018-10-03
Views: 1823 		1538553600 1823
Description:
Author: airibarren.1
Session Name: Ventana buena + Hubs
Genome Assembly: hg38
Creation Date: 2018-02-06
Views: 1761 		1517904000 1761
Description:
Author: airibarren.1
Session Name: Regulatory elements; epigentic marks
Genome Assembly: hg19
Creation Date: 2018-02-26
Views: 2269 		1519632000 2269
Description:
Author: airibarren.1
Session Name: Oregano
Genome Assembly: hg19
Creation Date: 2018-02-26
Views: 1992 		1519632000 1992
Description:
Author: airibarren.1
Session Name: NHLF
Genome Assembly: hg19
Creation Date: 2018-02-26
Views: 1967 		1519632000 1967
Description:
Author: airibarren.1
Session Name: NHEK
Genome Assembly: hg19
Creation Date: 2018-02-26
Views: 1927 		1519632000 1927
Description:
Author: airibarren.1
Session Name: K562
Genome Assembly: hg19
Creation Date: 2018-02-26
Views: 2020 		1519632000 2020
Description:
Author: airibarren.1
Session Name: HUVEC
Genome Assembly: hg19
Creation Date: 2018-02-26
Views: 2279 		1519632000 2279
Description:
Author: airibarren.1
Session Name: HSMM
Genome Assembly: hg19
Creation Date: 2018-02-26
Views: 2088 		1519632000 2088
Description:
Author: airibarren.1
Session Name: H1-hESC
Genome Assembly: hg19
Creation Date: 2018-02-26
Views: 2181 		1519632000 2181
Description:
Author: airibarren.1
Session Name: Genes and gene expression
Genome Assembly: hg19
Creation Date: 2018-02-26
Views: 1957 		1519632000 1957
Description:
Author: airibarren.1
Session Name: GM12878
Genome Assembly: hg19
Creation Date: 2018-02-26
Views: 1971 		1519632000 1971
Description:
Author: airibarren.1
Session Name: Evolution
Genome Assembly: hg19
Creation Date: 2018-02-26
Views: 2128 		1519632000 2128
Description:
Author: airibarren.1
Session Name: Ensembl segment
Genome Assembly: hg19
Creation Date: 2018-02-26
Views: 1923 		1519632000 1923
Description:
Author: airibarren.1
Session Name: Ensembl activity
Genome Assembly: hg19
Creation Date: 2018-02-26
Views: 1962 		1519632000 1962
Description:
Author: airibarren.1
Session Name: ChIp
Genome Assembly: hg19
Creation Date: 2018-02-26
Views: 1981 		1519632000 1981
Description:
Author: agacita
Session Name: Regulatory_Variants_Heart_333
Genome Assembly: hg19
Creation Date: 2018-05-11
Views: 2045 		1526025600 2045
Description:
Author: agacita
Session Name: Regulatory_Var_89912022_labels
Genome Assembly: hg19
Creation Date: 2018-05-10
Views: 2560 		1525939200 2560
Description:
Author: agacita
Session Name: Regulatory_Var_89912022_Final
Genome Assembly: hg19
Creation Date: 2018-05-11
Views: 2392 		1526025600 2392
Description:
Author: agacita
Session Name: Regulatory_Var_89912022
Genome Assembly: hg19
Creation Date: 2018-05-10
Views: 1826 		1525939200 1826
Description:
Author: afanas
Session Name: hg19-H3K27Ac
Genome Assembly: hg19
Creation Date: 2017-11-27
Views: 2449 		1511769600 2449
Description:
Author: gerbermm
Session Name: TAS2R38 Grp6 MG
Genome Assembly: hg19
Creation Date: 2019-01-14
Views: 2083 		1547452800 2083
Description:
Author: hammer
Session Name: piranha-eclip_sclip
Genome Assembly: hg38
Creation Date: 2018-08-27
Views: 1869 		1535356800 1869
Description:
Author: hkao
Session Name: SMARCC1 4-3
Genome Assembly: hg38
Creation Date: 2019-07-09
Views: 1623 		1562659200 1623
Description:
Author: hammer
Session Name: ablife
Genome Assembly: hg38
Creation Date: 2018-08-27
Views: 1948 		1535356800 1948
Description: RNA-seq in cell lines were carried out as follows: after MGC803 cells were transfected with siRNA against circMRPS35 or corresponding control in triplicate, total RNA were extracted and cDNA libraries were constructed for rRNA-depleted sample using the NEBNext® Ultra™ Directional RNA Library Prep Kit for Illumina according to the manufacturer’s instructions, and were sequenced on Illumina HiSeq Xten. RPKM method was used to determine the gene expression. The raw data were analyzed according to the DESeq2 method. Pathway analysis was used to find out the significant pathway of the differential genes according to KEGG database. For gene ontology (GO) analysis, we downloaded the GO annotations from NCBI, UniProt and the Gene Ontology. Fisher’s exact test was applied to identify the significant GO categories and FDR was used to correct the p-values.
Author: jieMM
Session Name: hg38_FINAL
Genome Assembly: hg38
Creation Date: 2019-11-05
Views: 3141 		1572940800 3141
Description:
Author: leonic
Session Name: bing li et al. m6A RIP
Genome Assembly: mm10
Creation Date: 2018-08-21
Views: 1895 		1534838400 1895
Description:
Author: zxtzhangqian
Session Name: 3a-140-IDH
Genome Assembly: mm9
Creation Date: 2018-08-20
Views: 2130 		1534752000 2130
Description:
Author: davis2018
Session Name: hg19_example_asl
Genome Assembly: hg19
Creation Date: 2018-08-20
Views: 1853 		1534752000 1853
Description:
Author: ruhollah
Session Name: hg19_29ChrX_nmt23
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1908 		1543219200 1908
Description:
Author: ruhollah
Session Name: hg19_13Chr3_nmt23
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1729 		1543219200 1729
Description: This session shows how the multi-region tool allows you to swap in alternate sequences into the main sequence, when desired. For example, if you click the "mutli-region" button under the Browser image (or go to the top "View" menu and then select it), you can paste chr5_KI270794v1_alt in the "Show one alternate haplotype, placed on its chromosome, using ID:" box and then also click the " Highlight alternating regions in multi-region view" box and the result is this session.<br> <br> This issue came up when a user was doing PCR and found two results, one on chr5 and one on chr5_KI270794v1_alt and wanted to understand the meaning of the chr5_..._alt PCR hit. On our gateway page for hg38 (http://genome.ucsc.edu/cgi-bin/hgGateway?db=hg38) you will find an Assembly Details section, which will explain how the Genome Reference Consortium (GRC) in building a reference assembly observed several human chromosomal regions exhibit sufficient variability to prevent adequate representation by a single sequence and to address this issue, the GRCh38/hg38 assembly provides alternate sequence for selected variant regions through the inclusion of alternate loci scaffolds (or alt loci). The assembly contains 261 alt loci, where this chr5_KI270794v1_alt is one of the regions that just happens to be right around the specific gene of interest. This GRC Assembly Terminology page is useful in learning the definition of alternate sequences: https://www.ncbi.nlm.nih.gov/grc/help/definitions/ The answer to the user was that in some ways one can interpret this additional chr5_KI270794v1_alt PCR result as a representation where the GRC determined an additional sequence provides an alternate representation of the same locus. And this session helps to visualize that alternate sequence in place around the rest of the chromosome. <img src="https://groups.google.com/a/soe.ucsc.edu/group/genome/attach/d6cb8d335b5b/image.png?part=0.1&authuser=0" alt="PCR results">
Author: brianlee
Session Name: hg38_ chr5_KI270794v1_alt
Genome Assembly: hg38
Creation Date: 2018-08-10
Views: 1845 		1533888000 1845
Description:
Author: chubukovp
Session Name: hg19_SMC_upload
Genome Assembly: hg19
Creation Date: 2016-10-14
Views: 2196 		1476432000 2196
Description:
Author: anglemem
Session Name: CGEMS Worm EA Test
Genome Assembly: ce11
Creation Date: 2018-08-30
Views: 1773 		1535616000 1773
Description:
Author: ruhollah
Session Name: hg19_170Chr1_nmt4
Genome Assembly: hg19
Creation Date: 2019-01-14
Views: 1719 		1547452800 1719
Description:
Author: ruhollah
Session Name: hg19_173Chr2_nmt4
Genome Assembly: hg19
Creation Date: 2019-01-14
Views: 1741 		1547452800 1741
Description: RNA-seq data from Lee HC et al. Open Biol. 2020 Feb. Molecular anatomy of the pre-primitive-streak chick embryo.
Author: stern_lab
Session Name: Lee HC et al. chick pre-primitive streak
Genome Assembly: galGal5
Creation Date: 2020-06-25
Views: 1651 		1593072000 1651
Description:
Author: cocopow
Session Name: hg38_bw_GSM1131536
Genome Assembly: hg38
Creation Date: 2019-03-07
Views: 1713 		1551945600 1713
Description:
Author: cocopow
Session Name: hg38_HGMDvsCurated
Genome Assembly: hg38
Creation Date: 2019-03-06
Views: 1951 		1551859200 1951
Description:
Author: cocopow
Session Name: danRer11_bw_GSM1131536
Genome Assembly: danRer11
Creation Date: 2019-03-07
Views: 1628 		1551945600 1628
Description:
Author: cocopow
Session Name: mm10_bejTB
Genome Assembly: mm10
Creation Date: 2019-08-01
Views: 1614 		1564646400 1614
Description:
Author: ascendgene
Session Name: 60genes panel chrX
Genome Assembly: hg19
Creation Date: 2018-07-25
Views: 1826 		1532505600 1826
Description:
Author: ascendgene
Session Name: 60genes panel chr22
Genome Assembly: hg19
Creation Date: 2018-07-25
Views: 1819 		1532505600 1819
Description:
Author: ascendgene
Session Name: 60genes panel chr17
Genome Assembly: hg19
Creation Date: 2018-07-25
Views: 1892 		1532505600 1892
Description:
Author: ascendgene
Session Name: 60genes panel chr16
Genome Assembly: hg19
Creation Date: 2018-07-25
Views: 1784 		1532505600 1784
Description:
Author: ascendgene
Session Name: 60genes panel chr14
Genome Assembly: hg19
Creation Date: 2018-07-25
Views: 1773 		1532505600 1773
Description:
Author: Gabriel
Session Name: LDTF-Kras
Genome Assembly: mm10
Creation Date: 2020-03-26
Views: 1561 		1585209600 1561
Description:
Author: ascendgene
Session Name: 60genes panel chr18
Genome Assembly: hg19
Creation Date: 2018-07-25
Views: 1697 		1532505600 1697
Description:
Author: dorothyzhao
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2019-08-13
Views: 1610 		1565683200 1610
Description:
Author: ascendgene
Session Name: 60genes panel chr19
Genome Assembly: hg19
Creation Date: 2018-07-25
Views: 1760 		1532505600 1760
Description: ReMap 2020: An atlas of regulatory regions from an integrative analysis Arabidopsis thaliana DNA-binding sequencing experiments. Go to <a href="http://remap.univ-amu.fr">ReMap</a> for more info.
Author: Benoit Ballester
Session Name: US_ReMap2020_Thaliana
Genome Assembly: hub_1936559_araTha1
Creation Date: 2019-08-29
Views: 11090 		1567065600 11090
Description:
Author: ascendgene
Session Name: 60genes panel chr15
Genome Assembly: hg19
Creation Date: 2018-07-25
Views: 1861 		1532505600 1861
Description:
Author: dantaki
Session Name: sv2_merge_debug
Genome Assembly: hg19
Creation Date: 2018-11-08
Views: 1835 		1541664000 1835
Description:
Author: dantaki
Session Name: ccr_hg19
Genome Assembly: hg19
Creation Date: 2018-12-12
Views: 1846 		1544601600 1846
Description: this is a test
Author: dandan_0909
Session Name: hg19_4_17
Genome Assembly: hg19
Creation Date: 2018-04-15
Views: 190 		1523779200 190
Description:
Author: ascendgene
Session Name: 60genes panel chr6
Genome Assembly: hg19
Creation Date: 2018-07-25
Views: 1969 		1532505600 1969
Description:
Author: danrlu
Session Name: Fuller_paper
Genome Assembly: dm6
Creation Date: 2019-10-25
Views: 2137 		1571990400 2137
Description:
Author: mersedehr
Session Name: NSUN4_v2_rs66575205
Genome Assembly: hg19
Creation Date: 2018-06-15
Views: 1814 		1529049600 1814
Description: This sessionView is a collection of tracks centered around epigenomics. The profiles displayed primarily belong to the H1 cell line, however different origin samples may be chosen in the track configurations. The display is organized with gene annotations and mRNA abundance first, followed by regulatory profiles in the form of <a href="https://www.ncbi.nlm.nih.gov/pubmed/21441907" target="_blank">chromatin states (ChromHMM)</a>. These data are followed by ChIP-seq tracks exploring various transcription factors and regulatory regions/promoter tracks looking at DNase/CpG/methylation. The final tracks are the <a href="https://www.nature.com/articles/ng.2653" target="_blank">GTEx combined eQTL</a>, which identifies genetic variants likely affecting proximal gene expression, and the GTEx Gene Expression, which shows median gene expression levels in 51 tissues and 2 cell lines. The region visualized is a ~12,000bp window surrounding the <a href="https://ghr.nlm.nih.gov/gene/BRCA1" target="_blank">BRCA1 gene</a> transcription start site. <a href="https://ghr.nlm.nih.gov/gene/BRCA1" target="_blank">BRCA1</a> is a tumor suppressor and housekeeping gene linked to increased susceptibility to breast cancer when <a href="https://www.ncbi.nlm.nih.gov/pubmed/16846527" target="_blank">certain epigenomic markers are present</a>.
Author: view
Session Name: Epigenomics
Genome Assembly: hg19
Creation Date: 2018-10-10
Views: 1914 		1539158400 1914
Description: This sessionView is a collection of tracks centered around clinical significance. Featured tracks include gene annotations, SNVs, CNVs, SVs, and our publications track built by mining sequences and SNPs in publications. The displayed region is a 294bp window looking at the CAG repeat linked to Huntington’s disease in the HTT gene. Two similar sessions are also available: <a href="http://genome.ucsc.edu/cgi-bin/hgTracks?hgS_doOtherUser=submit&hgS_otherUserName=view&hgS_otherUserSessionName=ClinicalLite" target="_blank">ClinicalLite</a> which has a reduced number of tracks for increased clarity, and <a href="http://genome.ucsc.edu/cgi-bin/hgTracks?hgS_doOtherUser=submit&hgS_otherUserName=view&hgS_otherUserSessionName=Clinical" target="_blank">Clinical</a> which is the most informative clinical view.
Author: view
Session Name: ClinicalZoom
Genome Assembly: hg19
Creation Date: 2018-10-10
Views: 13499 		1539158400 13499
Description: This sessionView is a collection of tracks centered around clinical significance. Featured tracks include gene annotations, SNVs, CNVs, SVs, a cancer mutation database and our publications track built by mining sequences and SNPs in publications. The displayed region is focused around the HTT gene, responsible for Huntington's disease and Lopes-Maciel-Rodan syndrome. Two similar sessions are also available: <a href="http://genome.ucsc.edu/cgi-bin/hgTracks?hgS_doOtherUser=submit&hgS_otherUserName=view&hgS_otherUserSessionName=ClinicalZoom" target="_blank">ClinicalZoom</a> which shows the bp resolution CAG repeat linked to Huntington's disease, as well as <a href="http://genome.ucsc.edu/cgi-bin/hgTracks?hgS_doOtherUser=submit&hgS_otherUserName=view&hgS_otherUserSessionName=ClinicalLite" target="_blank">ClinicalLite</a> which has a reduced number of tracks for increased clarity.
Author: view
Session Name: Clinical
Genome Assembly: hg19
Creation Date: 2018-10-10
Views: 3609 		1539158400 3609
Description: This sessionView is a collection of tracks centered around assembly support. The region displayed includes a reported GRC incident on hg19 which was then patched. It also showcases a gap which can lead to inconsistent or missing data on existing tracks; as seen by the Mappability and 1000 Genomes Project Accessible Regions tracks.
Author: view
Session Name: AssemblySupport
Genome Assembly: hg19
Creation Date: 2018-10-05
Views: 1878 		1538726400 1878
Description:
Author: ascendgene
Session Name: 60genes panel chr13
Genome Assembly: hg19
Creation Date: 2018-07-25
Views: 1999 		1532505600 1999
Description:
Author: ascendgene
Session Name: 60genes panel chr12
Genome Assembly: hg19
Creation Date: 2018-07-25
Views: 1828 		1532505600 1828
Description:
Author: ascendgene
Session Name: 60genes panel chr10
Genome Assembly: hg19
Creation Date: 2018-07-24
Views: 2271 		1532419200 2271
Description:
Author: csitans
Session Name: Mouse ncRNA HSCs
Genome Assembly: mm9
Creation Date: 2017-06-19
Views: 1856 		1497859200 1856
Description:
Author: cschee
Session Name: RNA_HEMa
Genome Assembly: hg19
Creation Date: 2016-06-14
Views: 2198 		1465891200 2198
Description:
Author: cschee
Session Name: RNA_A375
Genome Assembly: hg19
Creation Date: 2016-06-14
Views: 2084 		1465891200 2084
Description:
Author: cschee
Session Name: A375_K27me3
Genome Assembly: hg19
Creation Date: 2016-06-14
Views: 2061 		1465891200 2061
Description:
Author: cschee
Session Name: A375_K27Ac
Genome Assembly: hg19
Creation Date: 2016-06-15
Views: 2079 		1465977600 2079
Description:
Author: cschee
Session Name: A375_Input_21092016
Genome Assembly: hg19
Creation Date: 2016-09-21
Views: 2241 		1474444800 2241
Description:
Author: cschee
Session Name: A375_Input
Genome Assembly: hg19
Creation Date: 2016-06-15
Views: 2004 		1465977600 2004
Description:
Author: cosmid88
Session Name: SRY-SOX9-ChIP-Chip
Genome Assembly: mm8
Creation Date: 2013-06-29
Views: 2576 		1372492800 2576
Description:
Author: ascendgene
Session Name: 60genes panel chr9
Genome Assembly: hg19
Creation Date: 2018-07-24
Views: 1745 		1532419200 1745
Description:
Author: cyoung
Session Name: Young, Fall17, Uba1 example
Genome Assembly: mm9
Creation Date: 2017-09-10
Views: 1831 		1505030400 1831
Description:
Author: cyoung
Session Name: Fall17 Bio630 CY test
Genome Assembly: mm9
Creation Date: 2017-09-13
Views: 1786 		1505289600 1786
Description:
Author: cyoung
Session Name: Bio630 CRX variants Young
Genome Assembly: hg38
Creation Date: 2017-09-26
Views: 1857 		1506412800 1857
Description:
Author: ascendgene
Session Name: 60genes panel chr8
Genome Assembly: hg19
Creation Date: 2018-07-25
Views: 1790 		1532505600 1790
Description:
Author: ascendgene
Session Name: 60genes panel chr7
Genome Assembly: hg19
Creation Date: 2018-07-24
Views: 1739 		1532419200 1739
Description:
Author: ascendgene
Session Name: 60genes panel chr5
Genome Assembly: hg19
Creation Date: 2018-07-24
Views: 2071 		1532419200 2071
Description:
Author: ddunican
Session Name: MBD3 WT v KO medip-seq ion_torrent mm9
Genome Assembly: mm9
Creation Date: 2016-09-26
Views: 2225 		1474876800 2225
Description:
Author: ascendgene
Session Name: 60genes panel chr4
Genome Assembly: hg19
Creation Date: 2018-07-24
Views: 1934 		1532419200 1934
Description:
Author: ascendgene
Session Name: 60genes panel chr3
Genome Assembly: hg19
Creation Date: 2018-07-24
Views: 1837 		1532419200 1837
Description:
Author: ascendgene
Session Name: 60genes panel chr2
Genome Assembly: hg19
Creation Date: 2018-07-24
Views: 2291 		1532419200 2291
Description:
Author: Welekie
Session Name: mm10
Genome Assembly: mm10
Creation Date: 2020-05-20
Views: 1473 		1589961600 1473
Description:
Author: simonwang612
Session Name: worm_ChIP_seq_L4_0716
Genome Assembly: ce10
Creation Date: 2018-07-16
Views: 1900 		1531728000 1900
Description:
Author: olena
Session Name: OTC-regulatory
Genome Assembly: hg19
Creation Date: 2018-07-13
Views: 2017 		1531468800 2017
Description:
Author: jtm
Session Name: shiny_app_mm10_v1
Genome Assembly: mm10
Creation Date: 2018-07-11
Views: 2980 		1531296000 2980
Description:
Author: jtm
Session Name: shiny_app_hg38_v1
Genome Assembly: hg38
Creation Date: 2018-07-11
Views: 5087 		1531296000 5087
Description:
Author: Kyle@Arkell_Lab
Session Name: hg38_ZIC2_3'UTR_RNA_Annotation
Genome Assembly: hg38
Creation Date: 2018-07-10
Views: 2032 		1531209600 2032
Description:
Author: tonyzeng
Session Name: apa
Genome Assembly: hg19
Creation Date: 2018-07-06
Views: 2086 		1530864000 2086
Description:
Author: speese
Session Name: dm6 FlyVar track
Genome Assembly: dm6
Creation Date: 2018-07-05
Views: 1605 		1530777600 1605
Description:
Author: Mouro_81
Session Name: B6J vs 129S1 SNPs at Lrrfip2/Mlh1
Genome Assembly: mm10
Creation Date: 2017-05-15
Views: 2042 		1494835200 2042
Description:
Author: MeganDurham
Session Name: BRAF
Genome Assembly: hg19
Creation Date: 2018-04-24
Views: 2002 		1524556800 2002
Description:
Author: Leif.Benner
Session Name: Leif_session
Genome Assembly: dm3
Creation Date: 2015-04-11
Views: 2011 		1428739200 2011
Description:
Author: Lab252
Session Name: Roche_et_al_NAR_44_19_9315_2016
Genome Assembly: hg19
Creation Date: 2016-07-04
Views: 2138 		1467619200 2138
Description:
Author: Kurotaki
Session Name: mm10 tachibana
Genome Assembly: mm10
Creation Date: 2016-05-12
Views: 2123 		1463040000 2123
Description:
Author: Ketty
Session Name: hg38_ChiPseq CRISPR clones
Genome Assembly: hg38
Creation Date: 2019-06-20
Views: 1692 		1561017600 1692
Description:
Author: KateLawrensonCSHS
Session Name: OCAC_CIMBA_Oncoarray
Genome Assembly: hg19
Creation Date: 2016-05-03
Views: 2679 		1462262400 2679
Description:
Author: Vizoso1
Session Name: UBP10
Genome Assembly: sacCer3
Creation Date: 2017-07-25
Views: 2111 		1500969600 2111
Description:
Author: Vizoso1
Session Name: RSA4
Genome Assembly: sacCer3
Creation Date: 2017-07-25
Views: 2208 		1500969600 2208
Description:
Author: Vizoso1
Session Name: NMD3
Genome Assembly: sacCer3
Creation Date: 2017-07-25
Views: 1955 		1500969600 1955
Description:
Author: Vizoso1
Session Name: ENP1
Genome Assembly: sacCer3
Creation Date: 2017-07-25
Views: 2080 		1500969600 2080
Description:
Author: Tung
Session Name: ndst1_10snp
Genome Assembly: hg38
Creation Date: 2018-04-13
Views: 2140 		1523606400 2140
Screenshot not available
Click Here to view
 Description:
Author: Toma Matveeva
Session Name: CGEMS #1
Genome Assembly: sacCer3
Creation Date: 2016-07-21
Views: 2098 		1469088000 2098
Screenshot not available
Click Here to view
 Description:
Author: Tao Zhang
Session Name: chicken lncRNA
Genome Assembly: hub_30425_galGal4
Creation Date: 2016-11-28
Views: 2343 		1480320000 2343
Description:
Author: Robin
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2016-10-04
Views: 2105 		1475568000 2105
Description:
Author: Robin
Session Name: CHPv3 versus Sanger/CHPv2
Genome Assembly: hg19
Creation Date: 2016-07-11
Views: 2007 		1468224000 2007
Description:
Author: Rahman.team
Session Name: CART38A
Genome Assembly: hg38
Creation Date: 2018-10-30
Views: 1956 		1540886400 1956
Description:
Author: Rahman.team
Session Name: CART37A
Genome Assembly: hg19
Creation Date: 2018-10-30
Views: 2018 		1540886400 2018
Description:
Author: cocopow
Session Name: hg38_23676
Genome Assembly: hg38
Creation Date: 2019-06-20
Views: 1590 		1561017600 1590
Description:
Author: cocopow
Session Name: hg19_superDuperTrack
Genome Assembly: hg19
Creation Date: 2019-04-16
Views: 1911 		1555401600 1911
Description:
Author: cocopow
Session Name: hg19_DMR_chr2
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1682 		1554105600 1682
Description:
Author: cocopow
Session Name: hg19_DMR_1chr1_P180_P21_exm_3
Genome Assembly: hg19
Creation Date: 2019-03-21
Views: 1643 		1553155200 1643
Description:
Author: cocopow
Session Name: hg19_ChIA
Genome Assembly: hg19
Creation Date: 2019-03-21
Views: 1677 		1553155200 1677
Description:
Author: cocopow
Session Name: hg19_BedGraph
Genome Assembly: hg19
Creation Date: 2019-03-29
Views: 1776 		1553846400 1776
Description:
Author: cocopow
Session Name: danRer7_bw_GSM1131536
Genome Assembly: danRer7
Creation Date: 2019-03-07
Views: 1684 		1551945600 1684
Description: New_peaks_to_share_120121
Author: ankurucsc
Session Name: New_peaks_to_share_120121
Genome Assembly: mm10
Creation Date: 2021-01-11
Views: 22 		1610352000 22
Description: Peaks_from_start120121
Author: ankurucsc
Session Name: Peaks_from_start120121
Genome Assembly: mm10
Creation Date: 2021-01-11
Views: 28 		1610352000 28
Description:
Author: britnyblu
Session Name: rena_atac_data
Genome Assembly: mm10
Creation Date: 2019-08-15
Views: 1615 		1565856000 1615
Description:
Author: megallegos
Session Name: Biol 310: Module 2 TSS-seq
Genome Assembly: hg19
Creation Date: 2018-09-04
Views: 6078 		1536048000 6078
Description:
Author: mjulialamberti
Session Name: cxcl12
Genome Assembly: hg38
Creation Date: 2019-08-08
Views: 1657 		1565251200 1657
Description:
Author: vperreau@unimelb.edu.au
Session Name: mm10 Linnarsson Celltype autoscale
Genome Assembly: mm10
Creation Date: 2019-02-18
Views: 983 		1550476800 983
Description:
Author: masuping
Session Name: chr_lncRNA-seq_CPM
Genome Assembly: hg19
Creation Date: 2019-10-14
Views: 1592 		1571040000 1592
Description: Sept 10, 2024
Author: rchelsea
Session Name: hg38 CRX
Genome Assembly: hg38
Creation Date: 2024-09-11
Views: 266 		1726041600 266
Description:
Author: sajjeev
Session Name: foxa1_07222019
Genome Assembly: hg19
Creation Date: 2019-07-22
Views: 1645 		1563782400 1645
Screenshot not available
Click Here to view
 Description:
Author: sajjeev
Session Name: ICR_cmyc_07222019
Genome Assembly: hg19
Creation Date: 2019-07-22
Views: 1657 		1563782400 1657
Screenshot not available
Click Here to view
 Description:
Author: sajjeev
Session Name: 07222019
Genome Assembly: hg19
Creation Date: 2019-07-22
Views: 1569 		1563782400 1569
Description:
Author: mauriege
Session Name: Fall21 Yeast test (GEM)
Genome Assembly: sacCer3
Creation Date: 2021-09-04
Views: 1006 		1630742400 1006
Description:
Author: celiagonzalez98
Session Name: Class 1
Genome Assembly: hg38
Creation Date: 2020-02-10
Views: 1489 		1581321600 1489
Description:
Author: batra.anjali
Session Name: Spring19 Yeast test AB
Genome Assembly: sacCer3
Creation Date: 2019-01-11
Views: 1681 		1547193600 1681
Description:
Author: ruhollah
Session Name: hg19_1025_chr5_nmtf14
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1581 		1554105600 1581
Description:
Author: ruhollah
Session Name: hg19_830_chr6_nmtf15
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1609 		1554105600 1609
Description:
Author: ruhollah
Session Name: hg19_750_chr19_nmtf15
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1601 		1554105600 1601
Description:
Author: ruhollah
Session Name: hg19_199_chr8_nmtf16
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1611 		1554105600 1611
Description:
Author: ruhollah
Session Name: hg19_1405_chr16_nmtf16
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1923 		1554105600 1923
Description:
Author: ruhollah
Session Name: hg19_212_chr17_nmtf16
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1715 		1554105600 1715
Description:
Author: ruhollah
Session Name: hg19_131_chr2_nmtf17
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1636 		1554105600 1636
Description:
Author: ruhollah
Session Name: hg19_1163_chr1_nmtf18
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1672 		1554105600 1672
Description:
Author: ruhollah
Session Name: hg19_414_Chr8_nmtf19
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1650 		1554105600 1650
Description:
Author: ruhollah
Session Name: hg19_1617_chr1_nmtf20
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1676 		1554105600 1676
Description:
Author: ruhollah
Session Name: hg19_795_chr19_nmtf23
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1666 		1554105600 1666
Description:
Author: Boody09
Session Name: Boudreau Lab_human cardiac Ago2 HITS-CLIP
Genome Assembly: hg19
Creation Date: 2018-05-08
Views: 2069 		1525766400 2069
Description:
Author: ntinamu001
Session Name: NCOMMS-19-03087;HCT116_vs_DKO1
Genome Assembly: hg19
Creation Date: 2019-08-22
Views: 1595 		1566460800 1595
Description:
Author: ntinamu001
Session Name: NCOMMS-19-03087;Mouse_OE
Genome Assembly: mm9
Creation Date: 2019-08-22
Views: 1389 		1566460800 1389
Description:
Author: ntinamu001
Session Name: NCOMMS-19-03087;SH-SY5Y
Genome Assembly: hg19
Creation Date: 2019-08-22
Views: 1468 		1566460800 1468
Description:
Author: AlicePsyche
Session Name: zebrafish_enhancers
Genome Assembly: danRer7
Creation Date: 2018-04-04
Views: 1825 		1522828800 1825
Description:
Author: tschauer
Session Name: Harpprecht_NAR
Genome Assembly: dm6
Creation Date: 2019-03-27
Views: 1714 		1553673600 1714
Description:
Author: Boonede
Session Name: Spring19 Yeast Test DB
Genome Assembly: sacCer3
Creation Date: 2019-01-11
Views: 1729 		1547193600 1729
Description:
Author: frongemg
Session Name: Spring19 Yeast test MGF
Genome Assembly: sacCer3
Creation Date: 2019-01-11
Views: 1673 		1547193600 1673
Description:
Author: ruhollah
Session Name: hg19_172Chr3_nmt8
Genome Assembly: hg19
Creation Date: 2019-01-14
Views: 1842 		1547452800 1842
Description:
Author: ruckerhr
Session Name: Spring19 Yeast HR
Genome Assembly: sacCer3
Creation Date: 2019-01-09
Views: 1714 		1547020800 1714
Description:
Author: ruckerhr
Session Name: TAS2R8group4
Genome Assembly: hg19
Creation Date: 2019-01-14
Views: 1856 		1547452800 1856
Description:
Author: Artem Babaian
Session Name: LIONS_ENCODE_supplement
Genome Assembly: hg19
Creation Date: 2019-01-09
Views: 1772 		1547020800 1772
Description:
Author: gerbermm
Session Name: Spring19 Yeast test MG
Genome Assembly: sacCer3
Creation Date: 2019-01-08
Views: 1767 		1546934400 1767
Description:
Author: descentj
Session Name: Spring19YeastTestTD
Genome Assembly: sacCer3
Creation Date: 2019-01-08
Views: 1833 		1546934400 1833
Description:
Author: shashipujar
Session Name: Multiz_conservation_SP
Genome Assembly: hg38
Creation Date: 2018-06-18
Views: 2003 		1529308800 2003
Description:
Author: agacita
Session Name: DYB_Promoter
Genome Assembly: hg19
Creation Date: 2019-01-22
Views: 1765 		1548144000 1765
Description:
Author: lbenner
Session Name: fs(1)K741
Genome Assembly: dm6
Creation Date: 2017-09-11
Views: 1967 		1505116800 1967
Description:
Author: mersedehr
Session Name: NSUN4_v1_rs72886903
Genome Assembly: hg19
Creation Date: 2018-06-14
Views: 1720 		1528963200 1720
Description:
Author: shashaverygood@163.com
Session Name: DGRP2snp
Genome Assembly: dm3
Creation Date: 2018-06-14
Views: 1709 		1528963200 1709
Description:
Author: Annaneed
Session Name: Anna_GEL
Genome Assembly: mm9
Creation Date: 2018-06-08
Views: 1443 		1528444800 1443
Screenshot not available
Click Here to view
 Description:
Author: view
Session Name: 11
Genome Assembly: hg38
Creation Date: 2018-12-21
Views: 1783 		1545379200 1783
Description:
Author: GDJ_Duke
Session Name: Layden_liver_ATACseq
Genome Assembly: mm10
Creation Date: 2018-12-16
Views: 1736 		1544947200 1736
Description:
Author: nedbrewer66
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2018-12-18
Views: 1893 		1545120000 1893
Description:
Author: mfarkas03
Session Name: 1299To p53 mutants
Genome Assembly: hg19
Creation Date: 2018-06-07
Views: 1335 		1528358400 1335
Description:
Author: arem
Session Name: hg19-cc
Genome Assembly: hg19
Creation Date: 2019-02-08
Views: 2093 		1549612800 2093
Description:
Author: arem
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2019-02-08
Views: 2213 		1549612800 2213
Description:
Author: Mikhailova_li
Session Name: KB-1471A8.1
Genome Assembly: hg19
Creation Date: 2018-06-04
Views: 1998 		1528099200 1998
Description:
Author: Mikhailova_li
Session Name: session 3
Genome Assembly: hg19
Creation Date: 2018-06-03
Views: 1757 		1528012800 1757
Description:
Author: Mikhailova_li
Session Name: session 1
Genome Assembly: hg19
Creation Date: 2018-06-03
Views: 1769 		1528012800 1769
Description:
Author: brianlee
Session Name: hg38_chrM
Genome Assembly: hg38
Creation Date: 2018-06-01
Views: 1845 		1527840000 1845
Description: Our LOVD Variants track has variants from many LSDBs; our OMIM Alleles, GWAS Catalog, ClinVar Variants and other tracks in the Phenotypes & Literature group may provide clues to when a SNP is Clinical (LSDB,OMIM,TPA,Diagnostic)" per the Flagged SNPs track based on whether dbSNP's true-or-false "clinically-assoc" flag is set from NCBI's documentation.
Author: brianlee
Session Name: hg19_variants
Genome Assembly: hg19
Creation Date: 2018-06-01
Views: 1985 		1527840000 1985
Description:
Author: nehoralevi
Session Name: CTCF- macs2 control2
Genome Assembly: mm10
Creation Date: 2019-06-10
Views: 1618 		1560153600 1618
Description: Epigenome map of human fetal and iPSC-derived retinal pigment epithelium (RPE)
Author: s041629
Session Name: iPSCORE_RPE_session_hg19
Genome Assembly: hg19
Creation Date: 2018-05-31
Views: 2226 		1527753600 2226
Description: This session highlights data from the Brain Epigenome Hub, created by Peter Hickey, Lindsay Rizzardi, and Kaspar Hansen and others at Johns Hopkins University. The hub shows methylation, ATAC-seq, and RNAseq across different brain regions.
Author: chmalee
Session Name: hg19_brainEpigenome
Genome Assembly: hg19
Creation Date: 2018-05-30
Views: 2977 		1527667200 2977
Description:
Author: rezo
Session Name: ReCappable-seq
Genome Assembly: hg38
Creation Date: 2019-08-11
Views: 8120 		1565510400 8120
Description: 6 CLEAR-CLIP tracks from mouse keratinocytes in total. 3 showing CLEAR-CLIP reads from all miRNAs and 3 showing only miR-200 family specific reads. For each set of three there are Controls, miR-200 DKO and miR-200 inducible libraries.
Author: Bjerkega
Session Name: Bjerkega CLEAR-CLIP
Genome Assembly: mm10
Creation Date: 2019-10-04
Views: 1759 		1570176000 1759
Description:
Author: ltoker
Session Name: Marzi
Genome Assembly: hg19
Creation Date: 2021-01-05
Views: 1477 		1609833600 1477
Description:
Author: carlchancc
Session Name: 20191017_MC_Forelimb_Hindlimb_hg19
Genome Assembly: hg19
Creation Date: 2019-10-17
Views: 1709 		1571299200 1709
Description:
Author: hkao
Session Name: RHOA 2-2
Genome Assembly: hg38
Creation Date: 2019-07-09
Views: 1548 		1562659200 1548
Description:
Author: hkao
Session Name: NEFM 1-3
Genome Assembly: hg38
Creation Date: 2019-07-09
Views: 1596 		1562659200 1596
Description:
Author: ejlopezsoto
Session Name: Cacna1b e35-e41
Genome Assembly: hg19
Creation Date: 2019-07-11
Views: 1771 		1562832000 1771
Description: All patient isolates in PRJNA613958, with exception of MinION sequenced, were individually aligned against the NC_045512.2 reference with SNPs called for each isolate using 'ngskit4b kalign'. A matrix of all individual isolate SNP site loci (rows) and isolate base calls at that loci (cols) created with 'ngskit4b snpmarkers' and this matrix then processed with 'ngskit4b snps2pgsnps' to output the pgSNPs tracks. Tracks show, for each SNP loci, the number of isolates containing the displayed allele base. Tracks provided for age, sex and sample month.
Author: biodiscovery
Session Name: wuhCor1 PRJNA613958 allele components
Genome Assembly: wuhCor1
Creation Date: 2020-04-29
Views: 1660 		1588147200 1660
Description:
Author: eldadshulman
Session Name: Homer_newaproch
Genome Assembly: mm10
Creation Date: 2019-06-30
Views: 1547 		1561881600 1547
Description:
Author: ruhollah
Session Name: hg19_162Chr19_nmt4
Genome Assembly: hg19
Creation Date: 2019-01-14
Views: 1652 		1547452800 1652
Description:
Author: 704855238
Session Name: chip-seq_LiuZX_seh1
Genome Assembly: rn6
Creation Date: 2018-05-24
Views: 1933 		1527148800 1933
Description:
Author: zhangr100
Session Name: AHBEC_VitD
Genome Assembly: hg19
Creation Date: 2019-04-04
Views: 1734 		1554364800 1734
Description:
Author: liqing9102
Session Name: mm9
Genome Assembly: mm9
Creation Date: 2018-05-16
Views: 1845 		1526457600 1845
Description:
Author: avlasova
Session Name: tADseq.short-library.all_frames
Genome Assembly: hub_271523_TFbb_list180_linear
Creation Date: 2018-05-14
Views: 1973 		1526284800 1973
Description: Juniata Bioinformatics KH JL Lethal neonatal rigidity and multifocal seizure syndrome is characterized by underdeveloped brains and seizures that begin in-utero. Seizures continue after birth and result in death which occurs usually by the age of 4 months. The disease is caused by an insertion of an A in the BRAT1 gene. The normal BRAT1 gene function is to be a master controller of cell cycled checkpoint signaling pathways that are required for cellular responses to DNA damage.
Author: herrkx18
Session Name: Amish Lethal Neonatal rigidity and Seizure syndrome 2
Genome Assembly: hg19
Creation Date: 2020-02-27
Views: 1443 		1582790400 1443
Description: one fly one genome: H3 hybrid fly, hybrid genome sequencing and assembly
Author: msadams
Session Name: H3-2_dm6
Genome Assembly: dm6
Creation Date: 2019-10-24
Views: 661 		1571904000 661
Screenshot not available
Click Here to view
 Description:
Author: eldadshulman
Session Name: endVsStart_chr1_heart
Genome Assembly: mm10
Creation Date: 2018-05-03
Views: 1596 		1525334400 1596
Screenshot not available
Click Here to view
 Description:
Author: eldadshulman
Session Name: apa_heart
Genome Assembly: mm10
Creation Date: 2018-05-03
Views: 1527 		1525334400 1527
Description:
Author: ruhollah
Session Name: hg19_148Chr2_nmt3
Genome Assembly: hg19
Creation Date: 2019-01-14
Views: 1601 		1547452800 1601
Description:
Author: che7oz
Session Name: hg19-IRF8-DCCC
Genome Assembly: hg19
Creation Date: 2018-10-03
Views: 1849 		1538553600 1849
Description:
Author: estercastillo
Session Name: Reprogenetics_PGD
Genome Assembly: hg19
Creation Date: 2018-04-27
Views: 1803 		1524816000 1803
Description:
Author: lob5149
Session Name: TSC2
Genome Assembly: hg19
Creation Date: 2018-04-26
Views: 2026 		1524729600 2026
Description:
Author: lob5149
Session Name: AKT1
Genome Assembly: hg19
Creation Date: 2018-04-26
Views: 1803 		1524729600 1803
Description:
Author: lob5149
Session Name: MTOR
Genome Assembly: hg19
Creation Date: 2018-04-26
Views: 1753 		1524729600 1753
Description:
Author: estercastillo
Session Name: JuanMartinez_LifeSeq_AS
Genome Assembly: hg19
Creation Date: 2018-04-22
Views: 1990 		1524384000 1990
Description:
Author: prutten
Session Name: rs6702619_3C-Seq_2replicates
Genome Assembly: hg19
Creation Date: 2015-03-17
Views: 1901 		1426579200 1901
Description:
Author: estercastillo
Session Name: Lara_AS_LaPaz
Genome Assembly: hg19
Creation Date: 2018-04-19
Views: 1907 		1524124800 1907
Description:
Author: roseaux12
Session Name: jinliying_nk
Genome Assembly: hg19
Creation Date: 2018-08-22
Views: 1928 		1534924800 1928
Description:
Author: celiagonzalez98
Session Name: class 3 part 1
Genome Assembly: hg19
Creation Date: 2020-02-12
Views: 1429 		1581494400 1429
Description:
Author: arthurcheng
Session Name: hg38 ATAC-seq
Genome Assembly: hg38
Creation Date: 2019-01-23
Views: 1096 		1548230400 1096
Description:
Author: riguang zhao
Session Name: hg19_hemoglobin
Genome Assembly: hg19
Creation Date: 2019-03-12
Views: 1636 		1552377600 1636
Description:
Author: Xavier Rambout
Session Name: mm9 2019-03-11
Genome Assembly: mm9
Creation Date: 2019-03-11
Views: 1491 		1552291200 1491
Description:
Author: ruhollah
Session Name: hg19_128Chr19+167Chr19_nmt11+11
Genome Assembly: hg19
Creation Date: 2019-01-14
Views: 1645 		1547452800 1645
Description:
Author: Camila
Session Name: Enhancers-BreastCancersCells
Genome Assembly: hg19
Creation Date: 2018-04-21
Views: 1770 		1524297600 1770
Description:
Author: micca
Session Name: mm9_Buecker2014
Genome Assembly: mm9
Creation Date: 2018-04-03
Views: 1766 		1522742400 1766
Description: This session shows the ALDH2 gene, one of the two genes associated with alcohol intolerance in East Asian populations, in its entirety. Only the "UCSC Genes" track is enabled, showing two of the gene's potential isoforms. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: hg19_ALDH2
Genome Assembly: hg19
Creation Date: 2022-07-21
Views: 852 		1658390400 852
Description:
Author: Jcotney
Session Name: Mouse_chromhmm_15_18_state
Genome Assembly: mm10
Creation Date: 2018-10-20
Views: 906 		1540022400 906
Description:
Author: arem
Session Name: colon meth
Genome Assembly: hg19
Creation Date: 2019-03-06
Views: 1567 		1551859200 1567
Description:
Author: jtm
Session Name: shiny_app_hg38_v0
Genome Assembly: hg38
Creation Date: 2018-03-28
Views: 4356 		1522224000 4356
Description:
Author: Hanson258
Session Name: DNA Damage ChIP-seq
Genome Assembly: hg38
Creation Date: 2018-07-17
Views: 2466 		1531814400 2466
Description:
Author: ldistefano
Session Name: dm6_DiStefanoData
Genome Assembly: dm6
Creation Date: 2019-03-12
Views: 1560 		1552377600 1560
Screenshot not available
Click Here to view
 Description:
Author: jtm
Session Name: shiny_app_mm10_v0
Genome Assembly: mm10
Creation Date: 2018-04-04
Views: 2352 		1522828800 2352
Description:
Author: cocopow
Session Name: hg38_nucs
Genome Assembly: hg38
Creation Date: 2019-04-23
Views: 1586 		1556006400 1586
Description: The genes HBB and HBD are both expressed in red blood cells, but HBB is also expressed in many other tissues, whereas HBD is expressed in red cells almost exclusively.
Author: videoDemo1
Session Name: hg19_hemoglobin
Genome Assembly: hg19
Creation Date: 2018-03-13
Views: 1855 		1520928000 1855
Description:
Author: nehoralevi
Session Name: mm10-CTCF
Genome Assembly: mm10
Creation Date: 2019-06-03
Views: 2455 		1559548800 2455
Description: The GeneHancer database links human regulatory elements (enhancers and promoters) as arcs to their inferred target genes. Over 1 million regulatory elements obtained from seven genome-wide databases by GeneHancer are visualizable on the human hg19 and hg38 assemblies as color-coded curves ending on their respective targets. Read more about GeneHancer data on the track description page and this article <a href="https://www.ncbi.nlm.nih.gov/pubmed/28605766">GeneHancer: genome-wide integration of enhancers and target genes in GeneCards.</a>
Author: PublicSessions
Session Name: GeneHancer
Genome Assembly: hg38
Creation Date: 2019-05-31
Views: 1996 		1559289600 1996
Description:
Author: rafal.czapiewski@ed.ac.uk
Session Name: extended BACs and FOSMIDs
Genome Assembly: mm10
Creation Date: 2019-03-27
Views: 1924 		1553673600 1924
Description:
Author: AnaïsTest
Session Name: test
Genome Assembly: hg38
Creation Date: 2019-06-06
Views: 2075 		1559808000 2075
Description:
Author: brianlee
Session Name: test
Genome Assembly: hg38
Creation Date: 2019-06-06
Views: 1888 		1559808000 1888
Description:
Author: emmawentworth
Session Name: hg19-PWS
Genome Assembly: hg19
Creation Date: 2019-06-05
Views: 1956 		1559721600 1956
Description:
Author: cocopow
Session Name: mm10_altStrains
Genome Assembly: mm10
Creation Date: 2019-06-05
Views: 1598 		1559721600 1598
Description:
Author: evan_pepper
Session Name: extra_tRNAs_Analysis
Genome Assembly: hg19
Creation Date: 2018-03-08
Views: 1898 		1520496000 1898
Description:
Author: hchen17
Session Name: 20180307_1300_RESULTS_6pelvicFinStickleOut
Genome Assembly: hub_207981_oryLat03
Creation Date: 2018-03-07
Views: 1779 		1520409600 1779
Description:
Author: lboteva
Session Name: mm10_rif1_HP_
Genome Assembly: mm10
Creation Date: 2019-05-30
Views: 1826 		1559203200 1826
Description:
Author: lbennett
Session Name: impdh1retina
Genome Assembly: hg19
Creation Date: 2018-03-06
Views: 1839 		1520323200 1839
Description:
Author: ruhollah
Session Name: 12_ruh
Genome Assembly: hg38
Creation Date: 2018-11-13
Views: 1676 		1542096000 1676
Description:
Author: ruhollah
Session Name: hg19_2_chr8
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1699 		1543219200 1699
Description:
Author: yezheng
Session Name: HiC_ChIP-seq_short
Genome Assembly: hg19
Creation Date: 2018-03-04
Views: 1907 		1520150400 1907
Description:
Author: holdenl
Session Name: danRer11 zebrafish CNV across strains
Genome Assembly: danRer11
Creation Date: 2018-03-03
Views: 3457 		1520064000 3457
Description:
Author: estercastillo
Session Name: MartaRodriguez_Reus
Genome Assembly: hg19
Creation Date: 2018-02-28
Views: 2009 		1519804800 2009
Description:
Author: BenjaminMartin02
Session Name: Stefanska_data
Genome Assembly: hg19
Creation Date: 2018-02-14
Views: 2226 		1518595200 2226
Description:
Author: labrozam
Session Name: CGEMS Yeast AL
Genome Assembly: sacCer3
Creation Date: 2016-11-05
Views: 2090 		1478332800 2090
Description:
Author: labrozam
Session Name: CGEMS Worm AL test
Genome Assembly: ce11
Creation Date: 2016-11-20
Views: 1939 		1479628800 1939
Description:
Author: labrozam
Session Name: CGEMS Mouse AL test
Genome Assembly: mm9
Creation Date: 2016-11-29
Views: 2614 		1480406400 2614
Description:
Author: labrozam
Session Name: CGEMS Human AL test
Genome Assembly: hg38
Creation Date: 2016-11-21
Views: 1958 		1479715200 1958
Description:
Author: labrozam
Session Name: Anna-rs72802342
Genome Assembly: hg19
Creation Date: 2017-10-31
Views: 2220 		1509436800 2220
Description:
Author: jwjiao
Session Name: H2ZKO_E16_WT_E16
Genome Assembly: hg38
Creation Date: 2018-02-26
Views: 1861 		1519632000 1861
Description:
Author: troy.dumenil@qimr.edu.au
Session Name: MMR_branchpoints-230218
Genome Assembly: hg19
Creation Date: 2018-02-22
Views: 1801 		1519286400 1801
Description:
Author: yierjin_2008
Session Name: KMS12BM
Genome Assembly: hg19
Creation Date: 2018-02-22
Views: 1891 		1519286400 1891
Description: This session is an example of using the Short Match track to search a sequence in the current view with the IUPAC codes. The input of WACMKGTW catches two matches. The session also using a feature of the Base Position track. You can highlight specific nucleotides with that track and AAC are selected to be highlighted (note, there is also a step taken to check the box to show reverse complements of motifs). This region you will see AACATGTT and another reverse strand AACCTGTA, which appears to work with the IUPAC codes: http://genome.ucsc.edu/goldenPath/help/iupac.html The Base Track and the Short Match track allow you to investigate the sequence in the current view when zoomed in with these highlight and search features.
Author: brianlee
Session Name: hg38.WACMKGTW
Genome Assembly: hg38
Creation Date: 2018-02-21
Views: 1050 		1519200000 1050
Description:
Author: simonwang612
Session Name: worm-chip-L4
Genome Assembly: ce10
Creation Date: 2018-02-20
Views: 1886 		1519113600 1886
Description:
Author: simonwang612
Session Name: worm-chip
Genome Assembly: ce10
Creation Date: 2018-02-19
Views: 1973 		1519027200 1973
Description:
Author: estercastillo
Session Name: JudithArmstrong_predisposicio
Genome Assembly: hg19
Creation Date: 2018-02-18
Views: 1799 		1518940800 1799
Description:
Author: Mannu Walia
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2018-12-13
Views: 1801 		1544688000 1801
Description:
Author: AnUnroyalKing
Session Name: Gene_File_King
Genome Assembly: hg19
Creation Date: 2018-02-15
Views: 1771 		1518681600 1771
Description:
Author: cmhct7
Session Name: Mouse Quad Data
Genome Assembly: mm10
Creation Date: 2016-09-12
Views: 2009 		1473667200 2009
Description:
Author: clauhag
Session Name: ContactSites_mixedpopulations
Genome Assembly: hg19
Creation Date: 2016-12-18
Views: 2214 		1482048000 2214
Description:
Author: clauhag
Session Name: ContactSites_clones
Genome Assembly: hg19
Creation Date: 2016-12-18
Views: 2116 		1482048000 2116
Description:
Author: ascendgene
Session Name: 60genes panel chr11
Genome Assembly: hg19
Creation Date: 2018-07-25
Views: 1915 		1532505600 1915
Description:
Author: zunpengliu66
Session Name: WT and DGCR8_dex2 H3K9me3 ChIP-seq
Genome Assembly: hg19
Creation Date: 2018-04-11
Views: 1761 		1523433600 1761
Description:
Author: samross
Session Name: danRer7_48hpf_6dpfbrain_RRBS
Genome Assembly: danRer7
Creation Date: 2018-02-14
Views: 1787 		1518595200 1787
Description:
Author: Lorena8a
Session Name: trabajo genomics HSC
Genome Assembly: hg19
Creation Date: 2018-02-14
Views: 1938 		1518595200 1938
Description:
Author: oac7
Session Name: oac7_hg19_all_snvs
Genome Assembly: hg19
Creation Date: 2018-02-13
Views: 1925 		1518508800 1925
Description:
Author: AnUnroyalKing
Session Name: Ian_King_Settings
Genome Assembly: hg19
Creation Date: 2018-02-13
Views: 2055 		1518508800 2055
Description:
Author: marzoldr
Session Name: hg38 MAPT density graphs and such
Genome Assembly: hg38
Creation Date: 2018-02-13
Views: 1808 		1518508800 1808
Description:
Author: marzoldr
Session Name: hg38 MAPT alleles
Genome Assembly: hg38
Creation Date: 2018-02-13
Views: 1792 		1518508800 1792
Description:
Author: marzoldr
Session Name: hg19 RHO custom 1
Genome Assembly: hg19
Creation Date: 2018-02-13
Views: 1758 		1518508800 1758
Description: This assembly hub for the CG2 clonal zebrafish is part of a much larger collection of assembly hubs. The hub details can be found on the gateway page for this hub <a href="http://genome.ucsc.edu/cgi-bin/hgGateway?hubUrl=http://genome-test.cse.ucsc.edu/gbdb/hubs/genbank/vertebrate_other/hub.ncbi.txt&genome=GCA_001483285.1_CG2v1.0&position=lastDbPos" >found here.</a> The hub is Biosample: SAMN03964926 and has Assembly accession ID: GCA_001483285.1. <br> <br> The hub is is part of this much larger assembly hub collection, with a launching page <a href="http://genome-test.cse.ucsc.edu/~hiram/hubs/genbank/vertebrate_mammalian/vertebrate_mammalian.ncbi.html" >found here</a> (note these will launch on our test development site as this hub is considered a prototype and hasn't passed quality control). Once connected to the above hub you have access to all of these hubs, the launching page only makes it more easy to directly link to the Track Browsing page. When connected one can also go to the Gateway page (earlier link) and see a <b>Download files for this assembly hub:</b> section with a <code>wget</code> command to access all the files for these assembly hubs.
Author: brianlee
Session Name: CG2zebrafish
Genome Assembly: hub_89563_GCA_001483285.1_CG2v1.0
Creation Date: 2018-07-06
Views: 1801 		1530864000 1801
Description:
Author: AnUnroyalKing
Session Name: King_setting
Genome Assembly: hg19
Creation Date: 2018-02-15
Views: 2096 		1518681600 2096
Description:
Author: estercastillo
Session Name: pseudogens
Genome Assembly: hg19
Creation Date: 2018-01-31
Views: 2678 		1517385600 2678
Description:
Author: marylaws
Session Name: foxm1 chip comparison
Genome Assembly: hg19
Creation Date: 2018-02-07
Views: 1777 		1517990400 1777
Description:
Author: marylaws
Session Name: FOXM 231 and mcf7
Genome Assembly: hg18
Creation Date: 2018-02-07
Views: 2128 		1517990400 2128
Description: This session illustrates the meaning of columns in the axt file definition here, http://genome.ucsc.edu/goldenPath/help/axt.html You can see that indeed if you subtract to find the differences in the primary organism coordinates (panTro4: 78679-77637 = 1,042) it will be different than the values in the aligning organism coordinates (hg19: 88869-87772 = 1,097), but in the primary assembly sequence line you can see where there isn't a match in more than one place (most notable gct---------------------------------------------------ctt) as seen in this alignment of hg19 to panTro4. See the mailing list question here: <a href="https://groups.google.com/a/soe.ucsc.edu/d/msg/genome/-ohoSCyPIT0/c5nP7NzOBQAJ">link</a>.
Author: brianlee
Session Name: hg19.panTro4
Genome Assembly: hg19
Creation Date: 2018-02-02
Views: 1746 		1517558400 1746
Description:
Author: marzoldr
Session Name: TAS2R38 (T1)
Genome Assembly: hg19
Creation Date: 2018-01-23
Views: 2052 		1516694400 2052
Description:
Author: yezheng
Session Name: ATAC-seq_ALA_mm9
Genome Assembly: mm9
Creation Date: 2018-01-25
Views: 1928 		1516867200 1928
Description:
Author: ascendgene
Session Name: hg19_chr16:21960001-22400001
Genome Assembly: hg19
Creation Date: 2018-01-21
Views: 1886 		1516521600 1886
Description:
Author: chouhj
Session Name: noCHX_2017
Genome Assembly: sacCer3
Creation Date: 2017-08-14
Views: 1895 		1502697600 1895
Description:
Author: chouhj
Session Name: 46Del_2016batch
Genome Assembly: sacCer3
Creation Date: 2017-01-05
Views: 1928 		1483603200 1928
Description:
Author: chouhj
Session Name: 11Del_2015batch
Genome Assembly: sacCer3
Creation Date: 2017-01-05
Views: 2147 		1483603200 2147
Description:
Author: chmalee
Session Name: hg38notableChrYFeatures
Genome Assembly: hg38
Creation Date: 2017-03-06
Views: 2161 		1488787200 2161
Description:
Author: ascendgene
Session Name: hg19_chr15:32,020,001-32,420,001
Genome Assembly: hg19
Creation Date: 2018-01-21
Views: 2395 		1516521600 2395
Description:
Author: FrankaRang
Session Name: FR180123_mm10_groupmeeting
Genome Assembly: mm10
Creation Date: 2018-01-23
Views: 2186 		1516694400 2186
Description:
Author: zheyangshan
Session Name: EGFR BOTH
Genome Assembly: hg19
Creation Date: 2018-12-14
Views: 1567 		1544774400 1567
Description:
Author: rnaguru
Session Name: mm9-pY-MEME
Genome Assembly: mm9
Creation Date: 2018-01-18
Views: 2049 		1516262400 2049
Description: This assembly hub has a sequence that translates into a fun message when looking at codon translations.
Author: brianlee
Session Name: PAG_FUN
Genome Assembly: hub_211929_yourGenome
Creation Date: 2018-01-16
Views: 1973 		1516089600 1973
Description:
Author: tommi.andreani
Session Name: Neil.Methylome.Coverage10.WT.Clone5.DKO.clone7
Genome Assembly: mm10
Creation Date: 2018-01-12
Views: 1775 		1515744000 1775
Description:
Author: marzoldr
Session Name: Spring18 Yeast Test DMLJ
Genome Assembly: sacCer3
Creation Date: 2018-01-09
Views: 1756 		1515484800 1756
Description: This session shows TRPV3 which researchers believe is involved in our ability to sense and detect warm temperature. Scripps Research Institute scientists have demonstrated that mice lacking the TRPV3 protein have specific deficiencies in their ability to detect temperatures.
Author: brianlee
Session Name: skin_heat_sense
Genome Assembly: hg19
Creation Date: 2022-01-03
Views: 715 		1641196800 715
Description:
Author: megas
Session Name: hg19 Chip-Seq Encode vs mm10
Genome Assembly: hg19
Creation Date: 2018-01-02
Views: 1983 		1514880000 1983
Description: test the details .
Author: greece2019
Session Name: hg19_b0b1
Genome Assembly: hg19
Creation Date: 2019-03-03
Views: 1821 		1551600000 1821
Description:
Author: jkrakowiak
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2017-12-18
Views: 2347 		1513584000 2347
Description:
Author: jwjiao
Session Name: rbm3
Genome Assembly: mm10
Creation Date: 2017-12-17
Views: 1800 		1513497600 1800
Description: CircRNA and parental gene annotation as identified in the publication "Evolutionarily young transposable elements drive circular RNA repertoires" by Gruhl et al. (in preparation). The browser view include an additional track with the repeat dimers surrounding the respective circRNA.
Author: Frenzchen
Session Name: rheMac2 circRNA annotation
Genome Assembly: rheMac2
Creation Date: 2016-09-25
Views: 1377 		1474790400 1377
Description:
Author: mazawm
Session Name: hg#19RHO
Genome Assembly: hg19
Creation Date: 2018-11-13
Views: 1574 		1542096000 1574
Description:
Author: Heywhoyou22
Session Name: Nrl and wt Cbr sites
Genome Assembly: hg19
Creation Date: 2018-11-13
Views: 1639 		1542096000 1639
Description:
Author: nedbrewer66
Session Name: NAT7
Genome Assembly: hg38
Creation Date: 2018-12-28
Views: 1639 		1545984000 1639
Description:
Author: caojun
Session Name: Amr-20161031
Genome Assembly: mm9
Creation Date: 2016-10-31
Views: 2032 		1477900800 2032
Description:
Author: butlertj3
Session Name: nuc_g4
Genome Assembly: hg38
Creation Date: 2018-06-05
Views: 2029 		1528185600 2029
Description:
Author: butlertj3
Session Name: mtDNA_G4_homo_hetero
Genome Assembly: hg38
Creation Date: 2018-04-10
Views: 1973 		1523347200 1973
Description:
Author: brianlee
Session Name: sacCer3_spots
Genome Assembly: sacCer3
Creation Date: 2017-10-31
Views: 2005 		1509436800 2005
Description:
Author: brianlee
Session Name: hg38_interact_example
Genome Assembly: hg38
Creation Date: 2018-11-05
Views: 1736 		1541404800 1736
Description:
Author: brianlee
Session Name: hg38_GTEX_SUN
Genome Assembly: hg38
Creation Date: 2018-04-13
Views: 1864 		1523606400 1864
Description:
Author: brianlee
Session Name: hg38.exampleTracks
Genome Assembly: hg38
Creation Date: 2017-06-20
Views: 1875 		1497945600 1875
Description: Table browser output demonstrating cdsStart - cdsEnd and the UTR.
Author: brianlee
Session Name: hg38.cdsStart.cdsEnd
Genome Assembly: hg38
Creation Date: 2016-08-08
Views: 47 		1470643200 47
Description:
Author: brianlee
Session Name: hg38.SIRT1.relatedExpression
Genome Assembly: hg38
Creation Date: 2017-05-23
Views: 2330 		1495526400 2330
Description: The exon frames come from the mRNA, not the genome, and this example provided represents a transcript where there are deletions in respect to the reference. In the attached session you will see that there is a codon with a gap at chr19_KI270922v1_alt:123,732-123,733. Since the coding region is determined from the mRNA transcript, not from the aligned genomic chunk, exonFrames cannot be derived from the refGene cds and exon start/end table values, as some users have tried to implement in their interpretation code. One place to see these alignment details is also when clicking a RefSeq gene in the browser where you will find a section titled "mRNA/Genomic Alignments" where you can further click a link titled "View details of parts of alignment within browser window." There you can scroll down to a section titled "Side by Side Alignment" and see dots indicating a deletion in the alignment: 000896 a..ag 000898 >>>>>> | || >>>>>> 123731 aacag 123735
Author: brianlee
Session Name: hg38.NM_001282171.exon5
Genome Assembly: hg38
Creation Date: 2015-01-05
Views: 106 		1420444800 106
Description:
Author: brianlee
Session Name: hg19.pgSnpExample
Genome Assembly: hg19
Creation Date: 2017-07-19
Views: 1813 		1500451200 1813
Description:
Author: brianlee
Session Name: hg19.longTabix
Genome Assembly: hg19
Creation Date: 2017-05-24
Views: 1910 		1495612800 1910
Description: Genes like PEG3 and APEG3 in cattle (Bos taurus), in Bos taurus 2014 (bos tau8) in UCSC. If you scroll down to see the other tracks displayed you will find a "Cow mRNAs from GenBank" track that includes a displayed item, AY427787. Clinking into the details page for this item will lead you back to the NCBI mRNA information page: link http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Search&db=Nucleotide&term=AY427787&doptcmdl=GenBank&tool=genome.ucsc.edu This session of this region with AY427787 displayed at the top (you can drag and drop to reorder tracks).
Author: brianlee
Session Name: bosTau8.PEG
Genome Assembly: bosTau8
Creation Date: 2016-07-12
Views: 101 		1468310400 101
Description: This session shows a search of primers. A researcher had an issue building PCR primers and Browser staff discovered that a desired reverse primer falls into an area of repeats.  The original primer at 20 bases was near the limit of BLAT's sensitivity. With such short sequences, if BLAT has an over-used tile, a section of the query used to match and trigger an alignment, the algorithm will not be able to seed and extend an original BLAT hit in an area of repeats, which was what was likely happening to the reverse primer sequence in this session. In the session a larger BLAT query will result in a hit. Since primers are typically chosen from unique locations, Browser staff suggested it might be best to avoid a repeat-region, and noted that the nearby chr13:50,593,214-50,593,267 section appears to not have any repeats.
Author: brianlee
Session Name: Primers Blat Search
Genome Assembly: hg19
Creation Date: 2013-07-23
Views: 627 		1374566400 627
Description: This FORWARD strand session demonstrates how a user was using UCSC Genome tables to obtain exon sequences and their annotation and encountered a number of perceived discrepancies between the sequence data and the annotation, specifically asking "Why is the start position in the annotation consistently 1 nucleotide position before the start position for the sequence?" The response is that exon range provided with the sequence is 1-based because it is in position format, (chr#:##-##). While getting output as "all fields..." you see BED (chr# ## ##), 0-based format. This session shows how using the "all fields" output, we see this region full exon has exonStarts: 175629079, (but cdsEnd 175629122) with corresponding exonEnds:175629181. This is a reverse strand gene, so the last exon coordinates are really the beginning of the gene's first exon. So the applicable exonFrame items are the last two items "...,1,0,". But the last 0 here applies to the beginning of coding, cdsEnd coordinates (actually coding start since this is reverse strand). The second to last exonFrame, 1, refers to the exonStarts coordinates, 175629079, for an alanine, indicating exon2 picks up one nucleotide from the end of exon1.
Author: brianlee
Session Name: Example Session exonStarts exonEnds FORWARD
Genome Assembly: hg19
Creation Date: 2013-08-01
Views: 516 		1375344000 516
Description: This REVERSE strand session demonstrates how a user was using UCSC Genome tables to obtain exon sequences and their annotation and encountered a number of perceived discrepancies between the sequence data and the annotation, specifically asking "Why is the start position in the annotation consistently 1 nucleotide position before the start position for the sequence?" The response is that exon range provided with the sequence is 1-based because it is in position format, (chr#:##-##). While getting output as "all fields..." you see BED (chr# ## ##), 0-based format. This session shows how using the "all fields" output, we see this region full exon has exonStarts: 175629079, (but cdsEnd 175629122) with corresponding exonEnds:175629181. This is a reverse strand gene, so the last exon coordinates are really the beginning of the gene's first exon. So the applicable exonFrame items are the last two items "...,1,0,". But the last 0 here applies to the beginning of coding, cdsEnd coordinates (actually coding start since this is reverse strand). The second to last exonFrame, 1, refers to the exonStarts coordinates, 175629079, for an alanine, indicating exon2 picks up one nucleotide from the end of exon1.
Author: brianlee
Session Name: Example Session exonStarts exonEnds
Genome Assembly: hg19
Creation Date: 2013-07-31
Views: 465 		1375257600 465
Description:
Author: bisrat
Session Name: mm9
Genome Assembly: mm9
Creation Date: 2017-12-14
Views: 1874 		1513238400 1874
Description:
Author: bisrat
Session Name: mm10
Genome Assembly: mm10
Creation Date: 2018-09-18
Views: 2124 		1537257600 2124
Description:
Author: benbeijs
Session Name: MYBPC1 (JSB) CM Data
Genome Assembly: hg19
Creation Date: 2018-09-04
Views: 1709 		1536048000 1709
Description:
Author: benbeijs
Session Name: ENCODE Exercise, 3
Genome Assembly: hg19
Creation Date: 2018-11-13
Views: 1687 		1542096000 1687
Description:
Author: benbeijs
Session Name: ENCODE Exercise, 2
Genome Assembly: hg19
Creation Date: 2018-11-13
Views: 1689 		1542096000 1689
Description:
Author: benbeijs
Session Name: ENCODE Exercise
Genome Assembly: hg19
Creation Date: 2018-11-13
Views: 1672 		1542096000 1672
Description:
Author: benbeijs
Session Name: DSP (JSB) CM Data
Genome Assembly: hg19
Creation Date: 2018-09-05
Views: 1745 		1536134400 1745
Description:
Author: benbeijs
Session Name: AMD SNP (JSB), Exercise 3
Genome Assembly: hg19
Creation Date: 2018-10-02
Views: 1649 		1538467200 1649
Description:
Author: tommi.andreani
Session Name: Neil.Methylome.Coverage.Higher.10
Genome Assembly: mm10
Creation Date: 2017-12-12
Views: 1858 		1513065600 1858
Description:
Author: nicklewis
Session Name: AMD SNP Second Try
Genome Assembly: hg19
Creation Date: 2017-11-02
Views: 1756 		1509609600 1756
Description:
Author: nicklewis
Session Name: AMD SNP Custom Tracks
Genome Assembly: hg38
Creation Date: 2017-10-31
Views: 1787 		1509436800 1787
Description:
Author: cocapo
Session Name: hg38_multiWig_noOverlay
Genome Assembly: hg38
Creation Date: 2018-12-13
Views: 1640 		1544688000 1640
Description:
Author: roseaux12
Session Name: 3_subset_nk
Genome Assembly: hg19
Creation Date: 2018-12-13
Views: 1716 		1544688000 1716
Description:
Author: abner_lim
Session Name: OVcar
Genome Assembly: hg19
Creation Date: 2018-12-09
Views: 1696 		1544342400 1696
Description:
Author: GenePeeks
Session Name: .2017.12 60bp Multi-Seq-Alg
Genome Assembly: hg19
Creation Date: 2017-12-10
Views: 1696 		1512892800 1696
Description:
Author: rnkeith
Session Name: dm6_first_ribo-seq
Genome Assembly: dm6
Creation Date: 2019-05-02
Views: 1574 		1556784000 1574
Description:
Author: cath
Session Name: v440hgw0Test
Genome Assembly: hg38
Creation Date: 2016-10-25
Views: 1899 		1477382400 1899
Description:
Author: cath
Session Name: MLQ19469
Genome Assembly: hg19
Creation Date: 2017-05-24
Views: 2211 		1495612800 2211
Description: These are the 12 UCSC Browser tracks for the RNA-seq experiment in which humanized and WT yeast were subjected to 1 hour of splicing inhibitors. There are six libraries in duplicate. humanized hsh155 with DMSO carrier humanized hsh155 with 5 uM pladienolide-b humanized hsh155 with 0.5 uM pladienolide-b humanized hsh155 with 5 uM thailanstatin-a WT Hsh155 with DMSO carrier WT Hsh155 with 5 uM pladienolide-b
Author: ohunter
Session Name: Hunter_et_al_sacCer3_Yeast_Splicing_Inhibition
Genome Assembly: sacCer3
Creation Date: 2023-07-25
Views: 627 		1690272000 627
Description:
Author: cocopow
Session Name: hg18_44way
Genome Assembly: hg18
Creation Date: 2019-07-24
Views: 1646 		1563955200 1646
Description:
Author: kinerettaler
Session Name: danRer11
Genome Assembly: danRer11
Creation Date: 2018-12-30
Views: 1645 		1546156800 1645
Description: The GeneHancer track relates enhancer and promoters to their interactions with nearby genes. The interactions track in the pack setting allows for a pack view of the data with the direction and name of individual endpoints clearly displayed. A highlighted GH01J209814 enhancer is associated with the gene IRF6 (Interferon Regulatory Factor 6) located about 10kb upstream from the gene and harbors regulatory non-coding variants strongly associated to Van Der Woude Syndrome 1 (VWS1), a disease involving cleft lip and cleft palate.
Author: view
Session Name: GeneHancerPack
Genome Assembly: hg19
Creation Date: 2019-03-29
Views: 1522 		1553846400 1522
Description: The JASPAR 2018 TFB Public Hub represents genome-wide predicted binding sites for TF (transcription factor) binding profiles in the JASPAR CORE vertebrates collection. Please click into the Track Description pages to see more details and credits and contacts for the hub's data.
Author: brianlee
Session Name: hg38.JASPARhub
Genome Assembly: hg38
Creation Date: 2017-09-29
Views: 2508 		1506672000 2508
Description: With this session loaded navigate to the Variant Annotation Integrator (VAI) tool (under the top blue bar Tools menu). Then scroll down and click the "Get results" button to experience how the VAI tool can now output HGVS terms. This session is loaded with an artificial input of variants on the human hg38 assembly with NCBI RefSeq Genes track (curated NM_*, NR_*, and YP_* subset) filtered for coding exons and splice site roles and on DNase regulatory elements with output in HTML Variant Effect Predictor format where the "Extra" column will include HGVS notation. Please note that a semi-colon ";" will separate results in that field (HGVSG=NC_000010.11:g.27005592_27005594delAGA; HGVSCN=NM_014915.2:c.5129_5131delTCT; EXON=34/34).
Author: brianlee
Session Name: hg38.exampleVAI
Genome Assembly: hg38
Creation Date: 2017-09-25
Views: 4791 		1506326400 4791
Description:
Author: rasou2ba
Session Name: Bio 630 CRX variants Rasoul
Genome Assembly: hg38
Creation Date: 2017-09-27
Views: 1721 		1506499200 1721
Description:
Author: lianeslaughter
Session Name: mm9-Locus3_primerDesign
Genome Assembly: mm9
Creation Date: 2017-09-26
Views: 1843 		1506412800 1843
Description:
Author: Cong Guo
Session Name: IDEAS Blank
Genome Assembly: hg19
Creation Date: 2017-09-26
Views: 1697 		1506412800 1697
Description:
Author: Lou
Session Name: pisOchAsseblyHub
Genome Assembly: hub_1100339_12Jun2017_28pcJ
Creation Date: 2019-04-22
Views: 1840 		1555920000 1840
Description:
Author: peytonse
Session Name: Bio 630 CRX variants Peyton
Genome Assembly: hg38
Creation Date: 2017-09-20
Views: 1793 		1505894400 1793
Description:
Author: nickcochran
Session Name: BE2C_MAPT_9-18-17
Genome Assembly: hg19
Creation Date: 2017-09-18
Views: 2081 		1505721600 2081
Description:
Author: morotz
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2017-09-14
Views: 1883 		1505376000 1883
Description:
Author: EvansLab
Session Name: EY_ATAC_Ileum
Genome Assembly: mm9
Creation Date: 2017-09-12
Views: 1795 		1505203200 1795
Description:
Author: yezheng
Session Name: HiC_ChIP-seq
Genome Assembly: hg19
Creation Date: 2018-03-02
Views: 1780 		1519977600 1780
Description:
Author: leggeteg
Session Name: Leggett, BIO480Uba1 example
Genome Assembly: hg19
Creation Date: 2017-09-06
Views: 1865 		1504684800 1865
Description:
Author: ofery1984
Session Name: FINAL Meth + RNA
Genome Assembly: mm10
Creation Date: 2017-09-06
Views: 1191 		1504684800 1191
Description:
Author: mccarthyti
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2017-08-30
Views: 2289 		1504080000 2289
Description:
Author: jcarlevaro
Session Name: TE_paper_hg38
Genome Assembly: hg38
Creation Date: 2017-08-28
Views: 1775 		1503907200 1775
Description: We are pleased to add the UniBind Hub to our list of publicly available track hubs. UniBind is a comprehensive map of direct transcription factor - DNA interactions in the human genome. UniBind expands on the previous data and is now available on GRCh38/hg38. Below is a session highlighting UniBind transcription factor-DNA binding interactions in the SPR gene. http://genome.ucsc.edu/s/dschmelt/UniBindSRF More info on UniBind: https://unibind.uio.no We would like to thank the Mathelier Lab at the University of Oslo for creating this hub!
Author: dschmelt
Session Name: UniBindSRF
Genome Assembly: hg38
Creation Date: 2019-04-17
Views: 2530 		1555488000 2530
Description:
Author: oac7
Session Name: oac7_Problem_Set_2
Genome Assembly: hg19
Creation Date: 2018-03-01
Views: 1771 		1519891200 1771
Description: This data includes Bcl11b ChIP-seq result.
Author: liuxiaoqin
Session Name: bcl11b-liuxiaoqin
Genome Assembly: mm10
Creation Date: 2022-08-17
Views: 663 		1660723200 663
Description:
Author: aniclem
Session Name: Clem, BIO480 Uba 1 example
Genome Assembly: hg19
Creation Date: 2017-09-03
Views: 1893 		1504425600 1893
Description:
Author: EvansLab
Session Name: Eiji-ATACseq2
Genome Assembly: hg19
Creation Date: 2017-07-10
Views: 1984 		1499673600 1984
Description:
Author: EvansLab
Session Name: EY_ATAC_Intes_Organoids
Genome Assembly: mm9
Creation Date: 2017-07-26
Views: 2108 		1501056000 2108
Description: Visualization in UCSC Genome Browser of genome coverages of all generated next-generation sequencing data included in the manuscript ('A novel approach for DNA footprinting using short double-stranded cell-free DNA from plasma').
Author: jnmllr
Session Name: Short_cfDNA_seq_manuscript
Genome Assembly: hg19
Creation Date: 2024-02-13
Views: 528 		1707811200 528
Description:
Author: svadlamudi
Session Name: KSR2_7-24-17
Genome Assembly: hg19
Creation Date: 2017-07-24
Views: 1976 		1500883200 1976
Description:
Author: jwjiao
Session Name: H2AZ-ChIP-E13-Cortex
Genome Assembly: mm10
Creation Date: 2017-07-13
Views: 1999 		1499932800 1999
Description: This session is a response to question for research on Myc binding sites on the IDH1 gene promoter, with a desire to analyze the conservation of Myc binding sites between human and mouse. In the session Transcription Factor ChIP-seq (161 factors) from ENCODE track is displayed and three MYC binding spots represented. This clustered transcription factor binding track can be sorted to display only certain factors like MYC. Below the MYC binding spots (wgEncodeRegTfbsClusteredV3 track) the conservation data from 100 assembly alignments are displayed (cons100way track), with the specific data from mouse selected. Further below that the Chain/Net data (placentalChainNet track) specific for mouse are also displayed. To see this question on our Mailing List click this link: https://groups.google.com/a/soe.ucsc.edu/d/msg/genome/94u1jx2bk6c/py3OD90WAQAJ
Author: brianlee
Session Name: hg19.mycBinding2
Genome Assembly: hg19
Creation Date: 2017-07-13
Views: 1869 		1499932800 1869
Description:
Author: cocopow
Session Name: rn6_23676
Genome Assembly: rn6
Creation Date: 2019-06-20
Views: 1777 		1561017600 1777
Description:
Author: cocopow
Session Name: hg19_hubs
Genome Assembly: hg19
Creation Date: 2019-06-18
Views: 1548 		1560844800 1548
Description:
Author: Adhil
Session Name: sacCer3_supercoiling
Genome Assembly: sacCer3
Creation Date: 2019-06-17
Views: 1613 		1560758400 1613
Description:
Author: Joey Riepsaame
Session Name: mm9 DNAseI digital Me1 Me3 Ac27 Pol2
Genome Assembly: mm9
Creation Date: 2015-07-14
Views: 1230 		1436860800 1230
Description:
Author: janzop
Session Name: hsa_all_cccDNA_HBx_mRNA
Genome Assembly: hg38
Creation Date: 2017-06-20
Views: 2536 		1497945600 2536
Description:
Author: phageghost
Session Name: glasslab_microglia_hg38
Genome Assembly: hg38
Creation Date: 2017-06-19
Views: 2032 		1497859200 2032
Description:
Author: phageghost
Session Name: glasslab_microglia_mm10
Genome Assembly: mm10
Creation Date: 2017-06-19
Views: 1783 		1497859200 1783
Description: This sessionView is a collection of tracks centered around gene expression. The display is organized with gene annotations first, followed by mRNA and smRNA evidence. Following these data are <a href="https://www.nature.com/articles/ng.2653" target="_blank">GTEx tracks</a> which display median gene expression and transcripts from 51 tissues and 2 cells lines. The final tracks in this collection provide additional expression support: TSS/Dnase/chromatin state. The region visualized is a ~10,200bp window covering two <a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1891803/" target="_blank">HOX genes</a> which are regulators for embryonic development and continue to be expressed throughout postnatal life.
Author: view
Session Name: Expression
Genome Assembly: hg19
Creation Date: 2018-10-08
Views: 1788 		1538985600 1788
Description:
Author: nickcochran
Session Name: BE2C-Candidates-6-9-17
Genome Assembly: hg19
Creation Date: 2017-06-09
Views: 1885 		1496995200 1885
Description:
Author: ezra abramms
Session Name: nebulin bam site two
Genome Assembly: mm10
Creation Date: 2017-06-05
Views: 2000 		1496649600 2000
Description:
Author: wenzelmk
Session Name: BIO 481 hg38 CHR2 Chimp, Mouse, Chicken, Zebrafish
Genome Assembly: hg38
Creation Date: 2017-10-10
Views: 1829 		1507622400 1829
Description:
Author: peijinlim
Session Name: mm9 Nrf2 ChIPseq Mrp2
Genome Assembly: mm9
Creation Date: 2017-06-01
Views: 1890 		1496304000 1890
Description:
Author: yang1221720
Session Name: KDM3A_splicing
Genome Assembly: hg38
Creation Date: 2018-11-22
Views: 1641 		1542873600 1641
Description:
Author: ifollon
Session Name: hg19_sangre2
Genome Assembly: hg19
Creation Date: 2017-05-30
Views: 1986 		1496131200 1986
Description:
Author: jwrows2014
Session Name: EPAS1 search 5272017
Genome Assembly: hg38
Creation Date: 2017-05-27
Views: 1812 		1495872000 1812
Description: This session uses a new format called type=longTabix, here is a mailing list describing this type: https://groups.google.com/a/soe.ucsc.edu/d/msg/genome/kE2pIZUvfnA/jfopk7pFAQAJ This new type uses a custom track that points to a .gz file, and where that is located there is also a .gz.tbi file that provides the index. The tab-separated .gz file has contents like the following: chr19 44116910 44119168 chr21:47876840-47878656,2 31515 . The .tbi file is built using the tabix software from: http://samtools.sourceforge.net/tabix.shtml
Author: brianlee
Session Name: hg19.other_regions
Genome Assembly: hg19
Creation Date: 2017-05-25
Views: 1906 		1495699200 1906
Description:
Author: Fadak Alali
Session Name: Fall19 Yeast test FA
Genome Assembly: sacCer3
Creation Date: 2019-08-31
Views: 1461 		1567238400 1461
Description:
Author: ephong0305
Session Name: GeM MOA HD GWAS.v9
Genome Assembly: hg19
Creation Date: 2019-10-04
Views: 1572 		1570176000 1572
Description:
Author: Bowen
Session Name: hg38_HBB_rs334
Genome Assembly: hg38
Creation Date: 2019-10-24
Views: 1668 		1571904000 1668
Description:
Author: anneabraham1
Session Name: MAPT mutant alleles Anne Abraham
Genome Assembly: hg38
Creation Date: 2018-02-12
Views: 1789 		1518422400 1789
Description:
Author: XiangChen
Session Name: Bio481 Chen AMD SNPs rs67538026
Genome Assembly: hg38
Creation Date: 2017-10-31
Views: 2390 		1509436800 2390
Description:
Author: heathhm
Session Name: FALL19 Yeast test HMH
Genome Assembly: sacCer3
Creation Date: 2019-08-30
Views: 1636 		1567152000 1636
Description:
Author: farshad
Session Name: BRCA_hg19_H3K27Ac_related_profiles20170517
Genome Assembly: hg19
Creation Date: 2017-05-17
Views: 2164 		1495008000 2164
Description:
Author: ekrobins
Session Name: TSS_CAGE
Genome Assembly: hg19
Creation Date: 2017-05-17
Views: 2548 		1495008000 2548
Description:
Author: nbosch
Session Name: CRIM1
Genome Assembly: hg19
Creation Date: 2017-05-15
Views: 1884 		1494835200 1884
Description:
Author: brianlee
Session Name: hg38.refSeq.UCSC
Genome Assembly: hg38
Creation Date: 2017-05-12
Views: 2044 		1494576000 2044
Description:
Author: Francesco_Ferrari
Session Name: rs7599312_SNP
Genome Assembly: hg19
Creation Date: 2017-10-17
Views: 1781 		1508227200 1781
Description:
Author: sajjeev
Session Name: progeria_JB
Genome Assembly: mm10
Creation Date: 2019-05-23
Views: 2010 		1558598400 2010
Description:
Author: suestring
Session Name: example_DCdiffCA
Genome Assembly: hub_432097_DC
Creation Date: 2019-05-22
Views: 1701 		1558512000 1701
Description:
Author: suestring
Session Name: hub_432097_ZebraFish
Genome Assembly: hub_432097_ZebraFish
Creation Date: 2019-05-28
Views: 2469 		1559030400 2469
Description: Main overview of the ARID1a gene. Find the story in UCSC's education module: https://genome.ucsc.edu/training/education
Author: education
Session Name: arid1a_home
Genome Assembly: hg19
Creation Date: 2022-08-19
Views: 987 		1660896000 987
Description:
Author: cocopow
Session Name: hg38_primates
Genome Assembly: hg38
Creation Date: 2019-05-09
Views: 1610 		1557388800 1610
Description:
Author: russiandash
Session Name: mm10
Genome Assembly: mm10
Creation Date: 2019-05-13
Views: 4277 		1557734400 4277
Description:
Author: DearDanielxd
Session Name: mm10
Genome Assembly: mm10
Creation Date: 2017-04-25
Views: 1940 		1493107200 1940
Description:
Author: yayinano
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2017-04-21
Views: 2137 		1492761600 2137
Description:
Author: linzho
Session Name: Zoltan_SA3_chip_data
Genome Assembly: hg19
Creation Date: 2019-05-15
Views: 1641 		1557907200 1641
Description:
Author: swarnaseetha
Session Name: TET5hmcTriplicates
Genome Assembly: mm10
Creation Date: 2019-10-08
Views: 1539 		1570521600 1539
Description:
Author: i.bader@salk.at
Session Name: hg19_GJB2
Genome Assembly: hg19
Creation Date: 2019-05-15
Views: 1579 		1557907200 1579
Description:
Author: i.bader@salk.at
Session Name: hg19_SLC26A4
Genome Assembly: hg19
Creation Date: 2019-05-15
Views: 1619 		1557907200 1619
Description:
Author: sayloren
Session Name: hg19-chr12-probes
Genome Assembly: hg19
Creation Date: 2017-04-07
Views: 2027 		1491552000 2027
Description:
Author: GDJ_Duke
Session Name: SJC_BAC_Lib_GDJ_PER1_BAC
Genome Assembly: hg38
Creation Date: 2018-09-06
Views: 1792 		1536220800 1792
Description:
Author: liyq
Session Name: mm10_2016
Genome Assembly: mm10
Creation Date: 2017-03-18
Views: 1867 		1489824000 1867
Description:
Author: PublicSessions
Session Name: N-masked regions on the Y chromosome for hg38
Genome Assembly: hg38
Creation Date: 2017-03-14
Views: 2091 		1489478400 2091
Description:
Author: gartnerj928
Session Name: Devi_methyl_IP_tracks
Genome Assembly: mm10
Creation Date: 2017-03-13
Views: 2636 		1489392000 2636
Description:
Author: xulab
Session Name: tps_P0_ptm_H3K9me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1987 		1489132800 1987
Description:
Author: xulab
Session Name: tps_P0_ptm_H3K9ac
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 2260 		1489132800 2260
Description:
Author: xulab
Session Name: tps_P0_ptm_H3K4me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1879 		1489132800 1879
Description:
Author: xulab
Session Name: tps_P0_ptm_H3K4me2
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1843 		1489132800 1843
Description:
Author: xulab
Session Name: tps_P0_ptm_H3K4me1
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1898 		1489132800 1898
Description:
Author: xulab
Session Name: tps_P0_ptm_H3K36me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1865 		1489132800 1865
Description:
Author: xulab
Session Name: tps_P0_ptm_H3K27me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1933 		1489132800 1933
Description:
Author: xulab
Session Name: tps_P0_ptm_H3K27ac
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1920 		1489132800 1920
Description:
Author: xulab
Session Name: tps_E16_ptm_H3K9me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 2075 		1489132800 2075
Description:
Author: xulab
Session Name: tps_E16_ptm_H3K9ac
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1876 		1489132800 1876
Description:
Author: xulab
Session Name: tps_E16_ptm_H3K4me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1866 		1489132800 1866
Description:
Author: xulab
Session Name: tps_E16_ptm_H3K4me2
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1830 		1489132800 1830
Description:
Author: xulab
Session Name: tps_E16_ptm_H3K4me1
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1857 		1489132800 1857
Description:
Author: xulab
Session Name: tps_E16_ptm_H3K36me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1879 		1489132800 1879
Description:
Author: xulab
Session Name: tps_E16_ptm_H3K27me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1916 		1489132800 1916
Description:
Author: xulab
Session Name: tps_E16_ptm_H3K27ac
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1896 		1489132800 1896
Description:
Author: xulab
Session Name: tps_E15_ptm_H3K9me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1826 		1489132800 1826
Description:
Author: xulab
Session Name: tps_E15_ptm_H3K9ac
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1931 		1489132800 1931
Description:
Author: xulab
Session Name: tps_E15_ptm_H3K4me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1833 		1489132800 1833
Description:
Author: xulab
Session Name: tps_E15_ptm_H3K4me2
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1820 		1489132800 1820
Description:
Author: xulab
Session Name: tps_E15_ptm_H3K4me1
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 2013 		1489132800 2013
Description:
Author: xulab
Session Name: tps_E15_ptm_H3K36me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1821 		1489132800 1821
Description:
Author: xulab
Session Name: tps_E15_ptm_H3K27me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1857 		1489132800 1857
Description:
Author: xulab
Session Name: tps_E15_ptm_H3K27ac
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1996 		1489132800 1996
Description:
Author: xulab
Session Name: tps_E14_ptm_H3K9me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1855 		1489132800 1855
Description:
Author: xulab
Session Name: tps_E14_ptm_H3K9ac
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 2017 		1489132800 2017
Description:
Author: xulab
Session Name: tps_E14_ptm_H3K4me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1884 		1489132800 1884
Description:
Author: xulab
Session Name: tps_E14_ptm_H3K4me2
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1885 		1489132800 1885
Description:
Author: xulab
Session Name: tps_E14_ptm_H3K4me1
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1817 		1489132800 1817
Description:
Author: xulab
Session Name: tps_E14_ptm_H3K36me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1795 		1489132800 1795
Description:
Author: xulab
Session Name: tps_E14_ptm_H3K27me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1851 		1489132800 1851
Description:
Author: xulab
Session Name: tps_E14_ptm_H3K27ac
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1864 		1489132800 1864
Description:
Author: xulab
Session Name: tps_E14_ptm_CTCF
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1918 		1489132800 1918
Description:
Author: xulab
Session Name: tps_ALL_ptm_H3K9me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1960 		1489132800 1960
Description:
Author: xulab
Session Name: tps_ALL_ptm_H3K9ac
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1819 		1489132800 1819
Description:
Author: xulab
Session Name: tps_ALL_ptm_H3K4me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 2090 		1489132800 2090
Description:
Author: xulab
Session Name: tps_ALL_ptm_H3K4me2
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 2020 		1489132800 2020
Description:
Author: xulab
Session Name: tps_ALL_ptm_H3K4me1
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1943 		1489132800 1943
Description:
Author: xulab
Session Name: tps_ALL_ptm_H3K36me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1788 		1489132800 1788
Description:
Author: xulab
Session Name: tps_ALL_ptm_H3K27me3
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 2257 		1489132800 2257
Description:
Author: xulab
Session Name: tps_ALL_ptm_H3K27ac
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1976 		1489132800 1976
Description:
Author: xulab
Session Name: tps_ALL_ptm_CTCF
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 2079 		1489132800 2079
Description:
Author: xulab
Session Name: tps_P0_ptm_ALL
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1907 		1489132800 1907
Description:
Author: xulab
Session Name: tps_E16_ptm_ALL
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1861 		1489132800 1861
Description:
Author: xulab
Session Name: tps_E15_ptm_ALL
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1850 		1489132800 1850
Description:
Author: xulab
Session Name: tps_E14_ptm_ALL
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 1840 		1489132800 1840
Description:
Author: xulab
Session Name: tps_ALL_ptm_ALL
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 2651 		1489132800 2651
Description:
Author: ccornwel
Session Name: cfac
Genome Assembly: canFam3
Creation Date: 2016-09-26
Views: 1955 		1474876800 1955
Description:
Author: cocopow
Session Name: hg19-17q12
Genome Assembly: hg19
Creation Date: 2019-01-03
Views: 1745 		1546502400 1745
Description:
Author: rtmag4
Session Name: HCT116_ATAC_SEQ_TBLAB
Genome Assembly: hg38
Creation Date: 2017-03-03
Views: 1979 		1488528000 1979
Description:
Author: xulab
Session Name: tps_P0_ptm_CTCF
Genome Assembly: mm10
Creation Date: 2017-03-10
Views: 2257 		1489132800 2257
Description: Comparison of 7 primate genomes to the 2nd human chromosome.
Author: l.g.altizer
Session Name: 7Primate_Genomes
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 281 		1726560000 281
Description: Synteny and Conservation between Chimp and Human
Author: ALLDEREP
Session Name: Synteny and Conservation
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 243 		1726560000 243
Description:
Author: adriennelovett
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2017-02-24
Views: 1912 		1487923200 1912
Description: If you go to the Base Track you can do "Motifs to highlight: " and enter a sequence like TGT and it will highlight that anywhere on the screen.
Author: brianlee
Session Name: hg38.highlight.neat
Genome Assembly: hg38
Creation Date: 2017-02-22
Views: 28 		1487750400 28
Description:
Author: estercastillo
Session Name: AnaBelen_USalamanca_TP53
Genome Assembly: hg19
Creation Date: 2018-05-02
Views: 1923 		1525248000 1923
Description:
Author: Francesco_Ferrari
Session Name: AMLiPSC_H3K27Ac_ChIPseq_final_H3K27Ac
Genome Assembly: hg19
Creation Date: 2017-02-17
Views: 1912 		1487318400 1912
Description:
Author: jberus
Session Name: Bio2010-JB
Genome Assembly: hg18
Creation Date: 2017-02-16
Views: 1876 		1487232000 1876
Description:
Author: SB
Session Name: hg38_ALK E20 Cas9
Genome Assembly: hg38
Creation Date: 2017-02-15
Views: 2007 		1487145600 2007
Description: We have recently released a file type called "longTabix" which supports inter & intra-chromosomal interactions by drawing an "arc" among paired regions in the UCSC Genome Browser. Note the first track at the top of the display, you can click on any of the "arcs" or interaction connections to see details such as ID and score. Credit goes to Cath Tyner for the creation of this session. Link to the original question: https://groups.google.com/a/soe.ucsc.edu/d/msg/genome/kE2pIZUvfnA/jfopk7pFAQAJ
Author: PublicSessions
Session Name: Viewing inter- & intra-chromosomal interactions
Genome Assembly: hg19
Creation Date: 2017-02-13
Views: 1765 		1486972800 1765
Description:
Author: Francesco_Ferrari
Session Name: AMLiPSC_H3K27Ac_ChIPseq_CORRECTED
Genome Assembly: hg19
Creation Date: 2017-02-10
Views: 1831 		1486713600 1831
Description:
Author: Francesco_Ferrari
Session Name: AMLiPSC_H3K27Ac_ChIPseq_CORRECTED_autoscaled
Genome Assembly: hg19
Creation Date: 2017-02-13
Views: 1867 		1486972800 1867
Description:
Author: Francesco_Ferrari
Session Name: AMLiPSC_H3K27Ac_ChIPseq_days_5_20_35_40
Genome Assembly: hg19
Creation Date: 2017-02-01
Views: 1868 		1485936000 1868
Description:
Author: thomas.sparks
Session Name: 181227-atac1-encode_dnase
Genome Assembly: mm10
Creation Date: 2018-12-27
Views: 1684 		1545897600 1684
Description:
Author: xrdong10
Session Name: hg19_fdek
Genome Assembly: hg19
Creation Date: 2017-01-24
Views: 1938 		1485244800 1938
Description:
Author: rikrdo89
Session Name: rna-seq cardiac
Genome Assembly: mm9
Creation Date: 2017-01-24
Views: 1931 		1485244800 1931
Description:
Author: Francesco_Ferrari
Session Name: AMLiPSC_H3K27Ac_ChIPseq
Genome Assembly: hg19
Creation Date: 2017-01-23
Views: 1847 		1485158400 1847
Description:
Author: ryansamuel13
Session Name: TAS2R28 Gene
Genome Assembly: hg19
Creation Date: 2017-01-23
Views: 1898 		1485158400 1898
Description:
Author: Shockwing
Session Name: South, Spring17, Uba1 example
Genome Assembly: mm9
Creation Date: 2017-01-16
Views: 1914 		1484553600 1914
Description:
Author: ryansamuel13
Session Name: Samuel, Spring17, Uba1 example
Genome Assembly: mm9
Creation Date: 2017-01-16
Views: 1857 		1484553600 1857
Description:
Author: anneabraham1
Session Name: Spring18 Yeast test ALA
Genome Assembly: sacCer3
Creation Date: 2018-01-08
Views: 1758 		1515398400 1758
Description:
Author: harri5al
Session Name: Spring18 Yeast Test (AH)
Genome Assembly: sacCer3
Creation Date: 2018-01-08
Views: 1839 		1515398400 1839
Description:
Author: keitermd
Session Name: Spring17_Correct MOUSE TEST - MDK
Genome Assembly: mm9
Creation Date: 2017-01-09
Views: 2064 		1483948800 2064
Description:
Author: khan2sa
Session Name: Spring17 Mouse test (SK)
Genome Assembly: mm9
Creation Date: 2017-01-09
Views: 2122 		1483948800 2122
Description:
Author: ryansamuel13
Session Name: Spring17 Worm test (RMS)
Genome Assembly: ce11
Creation Date: 2017-01-09
Views: 1818 		1483948800 1818
Description:
Author: keitermd
Session Name: Spring17 MOUSE TEST - MDK
Genome Assembly: mm10
Creation Date: 2017-01-09
Views: 1837 		1483948800 1837
Description:
Author: lesevimx
Session Name: Spring17 Mouse test (ML)
Genome Assembly: mm9
Creation Date: 2017-01-09
Views: 1805 		1483948800 1805
Description:
Author: idror
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2017-01-03
Views: 2135 		1483430400 2135
Description:
Author: yuelab
Session Name: mm9_min
Genome Assembly: mm9
Creation Date: 2017-01-16
Views: 1938 		1484553600 1938
Description:
Author: warrenac
Session Name: GIT-mQTL-ASM
Genome Assembly: hg19
Creation Date: 2016-10-04
Views: 2323 		1475568000 2323
Description:
Author: jkearns94
Session Name: Fall 16 481 Final JK
Genome Assembly: mm9
Creation Date: 2016-12-12
Views: 1972 		1481529600 1972
Description:
Author: nightfury
Session Name: mm9-fam60a-de
Genome Assembly: mm9
Creation Date: 2016-12-11
Views: 2008 		1481443200 2008
Description: Since the reference genome assembly is a series of clone sequences from multiple individuals, and all individuals contain rare alleles, some of these rare alleles are included in reference assemblies. In this case, NM_001103170 (TGc), "c" mismatches the reference assemblies "A" because the reference sequence contains a substitution at this location. Please note that this example is on hg18, many (but not all) of these cases have been addressed in newer assemblies. AADACL3, in particular, does not have this substitution in GRCh38/hg38. Credit goes to Christopher Villarreal for creation of this session. Link to original question: https://groups.google.com/a/soe.ucsc.edu/d/msg/genome/6TG1Pze9rUI/TLsKg7bNAwAJ
Author: PublicSessions
Session Name: hg18.AADACL3_mRNA_discrepancy_vs_reference
Genome Assembly: hg18
Creation Date: 2016-12-09
Views: 1909 		1481270400 1909
Description:
Author: yezheng
Session Name: ATAC-seq_mm9_WT-+MU-+
Genome Assembly: mm9
Creation Date: 2019-01-31
Views: 1603 		1548921600 1603
Description:
Author: labrozam
Session Name: Labrozzi, Fall 17, Uba1 example
Genome Assembly: mm9
Creation Date: 2017-10-01
Views: 1765 		1506844800 1765
Description:
Author: cocopow
Session Name: hg19_bigBed12
Genome Assembly: hg19
Creation Date: 2019-03-21
Views: 1616 		1553155200 1616
Description:
Author: suestring
Session Name: ???
Genome Assembly: hub_162375_Pleuco
Creation Date: 2019-03-08
Views: 1547 		1552032000 1547
Description:
Author: suestring
Session Name: NotFusion
Genome Assembly: hub_162375_Pleuco
Creation Date: 2019-03-08
Views: 1655 		1552032000 1655
Description:
Author: suestring
Session Name: 2
Genome Assembly: hub_162375_Pleuco
Creation Date: 2019-03-08
Views: 1755 		1552032000 1755
Description:
Author: suestring
Session Name: 1
Genome Assembly: hub_162375_Pleuco
Creation Date: 2019-03-08
Views: 1678 		1552032000 1678
Description:
Author: arem
Session Name: hg19 fin
Genome Assembly: hg19
Creation Date: 2019-02-21
Views: 1967 		1550736000 1967
Description:
Author: sureshpsbio
Session Name: mm10_Chip fam40
Genome Assembly: mm10
Creation Date: 2019-02-20
Views: 2075 		1550649600 2075
Description:
Author: ruhollah
Session Name: hg19_1600_chr1_nmt=20
Genome Assembly: hg19
Creation Date: 2019-02-20
Views: 1564 		1550649600 1564
Description:
Author: ruhollah
Session Name: hg19_844_chr7_nmt20
Genome Assembly: hg19
Creation Date: 2019-02-20
Views: 1529 		1550649600 1529
Description:
Author: ruhollah
Session Name: hg19_412Chr8_nmt19
Genome Assembly: hg19
Creation Date: 2019-02-20
Views: 2146 		1550649600 2146
Description:
Author: ruhollah
Session Name: hg19_1148_chr1_nmt18
Genome Assembly: hg19
Creation Date: 2019-02-20
Views: 1608 		1550649600 1608
Description:
Author: liaohy
Session Name: RNAseq_Liu.DY_AM20181126-13
Genome Assembly: mm10
Creation Date: 2019-12-31
Views: 1474 		1577779200 1474
Description:
Author: ruhollah
Session Name: hg19_986_chr3_nmtf11
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1686 		1554105600 1686
Description:
Author: ruhollah
Session Name: hg19_1305_chr16_nmtf11
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1541 		1554105600 1541
Description:
Author: ruhollah
Session Name: hg19_1388_chr1_nmtf11
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1793 		1554105600 1793
Description:
Author: ruhollah
Session Name: hg19_1136_chr17_nmtf11
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1570 		1554105600 1570
Description:
Author: ruhollah
Session Name: hg19_1373_chr19_nmtf11
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1545 		1554105600 1545
Description:
Author: ruhollah
Session Name: hg19_1044_chr2_nmtf11
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1608 		1554105600 1608
Description:
Author: ruhollah
Session Name: hg19_128_chr14_nmtf11
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1544 		1554105600 1544
Description:
Author: ruhollah
Session Name: hg19_511_chr14_nmtf11
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1757 		1554105600 1757
Description:
Author: ruhollah
Session Name: hg19_1111_chr9_nmtf11
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1606 		1554105600 1606
Description:
Author: ruhollah
Session Name: hg19_237_chr22_nmtf12
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1814 		1554105600 1814
Description:
Author: ruhollah
Session Name: hg19_1327_chr17_nmtf12
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1767 		1554105600 1767
Description:
Author: ruhollah
Session Name: hg19_40_chr22_nmtf12
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1854 		1554105600 1854
Description:
Author: ruhollah
Session Name: hg19_954_chr1_nmtf12
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1592 		1554105600 1592
Description:
Author: ruhollah
Session Name: hg19_1129_chr17_nmtf12
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1729 		1554105600 1729
Description:
Author: ruhollah
Session Name: hg19_960_chrX_nmtf13
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1700 		1554105600 1700
Description:
Author: ruhollah
Session Name: hg19_662_chr6_nmtf13
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1525 		1554105600 1525
Description:
Author: ruhollah
Session Name: hg19_876_chr17_nmtf13
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1537 		1554105600 1537
Description:
Author: ruhollah
Session Name: hg19_149_chr1_nmtf13
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1560 		1554105600 1560
Description:
Author: bashamal
Session Name: basham hg38 assignment 10/10
Genome Assembly: hg38
Creation Date: 2017-10-09
Views: 1882 		1507536000 1882
Description:
Author: vperreau@unimelb.edu.au
Session Name: mm10 celltype NTRK2
Genome Assembly: mm10
Creation Date: 2018-12-04
Views: 950 		1543910400 950
Screenshot not available
Click Here to view
 Description:
Author: Tao Zhang
Session Name: chicken transcriptome
Genome Assembly: hub_30425_galGal4
Creation Date: 2016-11-29
Views: 2525 		1480406400 2525
Description:
Author: chkcole
Session Name: TN5_Prime_Alignments
Genome Assembly: hg38
Creation Date: 2017-10-24
Views: 2374 		1508832000 2374
Screenshot not available
Click Here to view
 Description:
Author: maria pia miano
Session Name: hg19s
Genome Assembly: hg19
Creation Date: 2016-11-16
Views: 2064 		1479283200 2064
Description:
Author: jtm
Session Name: shiny_app_mm10_v2
Genome Assembly: mm10
Creation Date: 2018-11-05
Views: 1963 		1541404800 1963
Description:
Author: headricn
Session Name: Fall16 481 final CH
Genome Assembly: mm9
Creation Date: 2016-12-11
Views: 2003 		1481443200 2003
Screenshot not available
Click Here to view
 Description:
Author: Courtney Stout
Session Name: AMD hg38 APOE SNP (CS)
Genome Assembly: hg38
Creation Date: 2016-11-04
Views: 2022 		1478246400 2022
Screenshot not available
Click Here to view
 Description:
Author: Courtney Stout
Session Name: hg38 AMD CNN2 SNP (CS)
Genome Assembly: hg38
Creation Date: 2016-11-04
Views: 1978 		1478246400 1978
Screenshot not available
Click Here to view
 Description:
Author: Courtney Stout
Session Name: hg38 AMD APOE SNP(CS)
Genome Assembly: hg38
Creation Date: 2016-11-04
Views: 2062 		1478246400 2062
Screenshot not available
Click Here to view
 Description:
Author: Courtney Stout
Session Name: hg38 AMD SNPs
Genome Assembly: hg38
Creation Date: 2016-10-27
Views: 1990 		1477555200 1990
Description: This session highlights the differences in microRNA expression between endothelial cells and other primary cells types. The data in this session comes from the "Towards the human cellular microRNAome" public hub, created by Marc Halushka and Arun Patil at the Johns Hopkins Medical Institute.
Author: chmalee
Session Name: hg38_microRNA_cell_expression
Genome Assembly: hg38
Creation Date: 2017-09-11
Views: 3160 		1505116800 3160
Description:
Author: troy.dumenil@qimr.edu.au
Session Name: MMR-branchpoints-260318
Genome Assembly: hg19
Creation Date: 2018-03-26
Views: 1863 		1522051200 1863
Description:
Author: rmaus
Session Name: nha_PE
Genome Assembly: mm8
Creation Date: 2016-10-18
Views: 1993 		1476777600 1993
Description:
Author: Sega666
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2016-10-19
Views: 1903 		1476864000 1903
Description:
Author: cath
Session Name: v339publicSessionTest
Genome Assembly: hg38
Creation Date: 2016-10-04
Views: 2330 		1475568000 2330
Screenshot not available
Click Here to view
 Description:
Author: Isilver1
Session Name: PCBP2_CLIP-seq_Reps1-3
Genome Assembly: mm10
Creation Date: 2017-03-28
Views: 2149 		1490688000 2149
Description:
Author: Sega666
Session Name: 02.11
Genome Assembly: hg19
Creation Date: 2016-11-02
Views: 1990 		1478073600 1990
Description:
Author: artman1967
Session Name: hg19_ATAC_2019
Genome Assembly: hg19
Creation Date: 2019-03-28
Views: 1706 		1553760000 1706
Description:
Author: mirigitik
Session Name: bahcc1
Genome Assembly: mm9
Creation Date: 2016-05-16
Views: 2374 		1463385600 2374
Description:
Author: sergi.villatoro
Session Name: Pangaea Biotech
Genome Assembly: hg19
Creation Date: 2016-09-14
Views: 1997 		1473840000 1997
Description:
Author: zxtzhangqian
Session Name: 3a-tet2
Genome Assembly: mm9
Creation Date: 2016-09-14
Views: 2015 		1473840000 2015
Description:
Author: vivekgopalanmedgenome
Session Name: hg19_panel_design_JRK
Genome Assembly: hg19
Creation Date: 2016-09-11
Views: 2013 		1473580800 2013
Description: Transcription Factor ChIP-seq track, which illustrates various transcription factor binding sites near genes of interest. Here is a session illustrating EP300 (p300) binding sites, along with H3K4me1, H3K27ac and H3K4me3 data, near the TNFAIP3 gene
Author: brianlee
Session Name: hg19.EP300
Genome Assembly: hg19
Creation Date: 2016-09-08
Views: 39 		1473321600 39
Description:
Author: sergi.villatoro
Session Name: Pangaea Biotech GenneReader
Genome Assembly: hg19
Creation Date: 2016-09-16
Views: 1913 		1474012800 1913
Description:
Author: sushivision
Session Name: TKNK31-090116
Genome Assembly: mm9
Creation Date: 2016-09-02
Views: 1891 		1472803200 1891
Screenshot not available
Click Here to view
 Description:
Author: lijunyao@usc.edu
Session Name: C2H2_type_1
Genome Assembly: hg19
Creation Date: 2016-09-01
Views: 1956 		1472716800 1956
Description:
Author: sambuca_shot
Session Name: mouse_reprog
Genome Assembly: mm10
Creation Date: 2016-03-23
Views: 2101 		1458720000 2101
Description: GTEx Allele Specific Expression hub from the Lappalainen Lab at the New York Genome Center. This session shows a region along chromosome 17 of high skin-specific allelic imbalance in a large number of Keratin genes.
Author: chmalee
Session Name: hg19KeratinAse
Genome Assembly: hg19
Creation Date: 2016-08-30
Views: 3011 		1472544000 3011
Description:
Author: pfiziev
Session Name: t_cell_development.H3K4me2 DECSTEP
Genome Assembly: mm9
Creation Date: 2016-08-26
Views: 2270 		1472198400 2270
Description:
Author: ps
Session Name: hg19.newTargets
Genome Assembly: hg19
Creation Date: 2016-08-26
Views: 2044 		1472198400 2044
Description: We sequenced the hermaphroditic freshwater snail, Biomphalaria glabrata (strain BB02), the host for the medically important trematode parasite, Schistosoma mansoni, using 1X coverage from plasmids and 0.1X BAC end sequencing on the ABI3730xl and 10X coverage sequenced on the Roche 454 Sequencer (including 2 paired end read runs) was initially assembled with Newbler. The Newbler assembly was screened for contamination then merged with a Soap assembly of Illumina reads followed by use of an in-house program for collapsing of redundant heterozygous contigs. Next, we applied our program, GapCloser, which closes gaps in the assembly by making iterative joins using Illumina reads. Finally we removed contigs less than 200 bases and incorporated reads into the assembly that had been assembled in a prior version of the Newbler assembly but were not assembled in this round. The resulting assembly, going by the name of assembly version 4.3, is 898.9Mb bases with an N50 contig length of 6.9kb and N50 scaffold length of 42kb. For creation of the linkage group AGP files, we identified all scaffolds that were uniquely placed on a single linkage group. Because of low marker density, only 145Mb was localized to specific linkage groups and scaffolds could not be ordered and oriented within linkage groups. Therefore, the scaffolds were simply placed in the order suggested by the linkage mapping on *_random for each linkage group. Credits: B. glabrata BB02 samples - Omar dos Santos Carvalho, Centro de Pesquisas Rene Rachou-Fiocruz (sample location: Barreiro, Brazil) BAC library - Coen M. Adema et al. (2006) Sequencing and Assembly - The Genome Institute, Washington University School of Medicine Linkage map - Jacob Tennessen and Michael Blouin, Oregon State University White Paper - Matty Knight et al (2003) Others - - Fred Lewis Biomedical Research Institute of the American Foundation of Biomedical Research - Eric Loker University of New Mexico Biology - Nithya Raghavan Biomedical Research Institute of the American Foundation of Biomedical Research
Author: lijing
Session Name: hub_107761_bioGla0
Genome Assembly: hub_107761_bioGla0
Creation Date: 2016-08-24
Views: 2101 		1472025600 2101
Description:
Author: elinshiao
Session Name: HEK293T_all
Genome Assembly: hg19
Creation Date: 2020-09-07
Views: 2007 		1599465600 2007
Description:
Author: mperelis
Session Name: Stein_PDX1
Genome Assembly: mm10
Creation Date: 2016-09-30
Views: 2133 		1475222400 2133
Description:
Author: treparriscos
Session Name: Sara_poised_enhancers_1xnorm_mm10_2
Genome Assembly: mm10
Creation Date: 2016-06-03
Views: 1516 		1464940800 1516
Description:
Author: sappingtonae
Session Name: test
Genome Assembly: hg38
Creation Date: 2016-08-15
Views: 2155 		1471248000 2155
Description:
Author: yezheng
Session Name: ATAC-seq_mm9
Genome Assembly: mm9
Creation Date: 2018-01-22
Views: 2298 		1516608000 2298
Description:
Author: robert-cornell@uiowa.edu
Session Name: Lidral, hg19, CL/P GWAS intervals
Genome Assembly: hg19
Creation Date: 2014-09-18
Views: 1823 		1411027200 1823
Description:
Author: shiguoming
Session Name: mm9_160812
Genome Assembly: mm9
Creation Date: 2016-08-11
Views: 1554 		1470902400 1554
Description:
Author: ykumar84
Session Name: mm10_Oct4
Genome Assembly: mm10
Creation Date: 2019-07-22
Views: 1779 		1563782400 1779
Description: This is an assembly hub for the AgamP4 assembly of Anopheles gambiae PEST strain. It includes the assembly; the coding genes and pseudogenes from vectorbase version 4.3; predicted stop codon readthrough regions; PhyloCSF tracks showing evolutionary protein-coding potential; splice-prediction tracks using the maximum-entropy splice-prediction algorithm; and novel coding and pseudogene predictions using PhyloCSF, excluding regions already annotated in vectorbase version 4.3.
Author: iljungr
Session Name: AgamP4
Genome Assembly: hub_102577_AgamP4
Creation Date: 2016-08-09
Views: 2703 		1470729600 2703
Description: A question about obtaining the sequence of the BAC RP23-470O14. Only the ends of this clone have been sequenced. This is a session to the mm9 assembly where you can see the mapping of these ends. If you click into the RP23-470O14 item you can see a "Genomics alignments..." section where you can click the "View details of parts of alignment within browser window" to see more details about the sequence as aligned to the browser. When on that details page, if you click the top blue bar "Tools" menu and select the "Table Browser" and you will arrive with the BAC End Pairs track and bacEndPairs table selected (be sure the radio button under the table name is set to "region: genome"). If you click into the "identifiers: paste list" section you can enter "RP23-470O14" to select this specific data and click "submit." Then you can change the "output format:" to "sequence" and click "get output." With the default setting you will get the known clone end sequences (Blocks) in upper case and filled in sequence from the reference assembly in lower-case letters. If you only want the known clone ends, uncheck the "Regions between blocks" before clicking "get sequence" and you can further change the "One FASTA record per item" to have an entry "...per region" and get output like this for each of the ends of the clone: mm9_bacEndPairs_RP23-470O14_0 range=chr3:101321490-101321978 5'pad=0 3'pad=0 strand=- repeatMasking=none GACAAGAAAAAGGAACT... mm9_bacEndPairs_RP23-470O14_1 range=chr3:101117036-101117526 5'pad=0 3'pad=0 strand=- repeatMasking=none TGTGCAACAGCCACTTCCC.....
Author: brianlee
Session Name: mm9.RP23.470O14
Genome Assembly: mm9
Creation Date: 2016-08-03
Views: 1757 		1470211200 1757
Description:
Author: cocopow
Session Name: hub_1567195_araTha1_remap
Genome Assembly: hub_1567195_araTha1
Creation Date: 2019-09-04
Views: 1995 		1567584000 1995
Description:
Author: QAtester3
Session Name: ce11_ENCODE_hub
Genome Assembly: ce11
Creation Date: 2018-02-08
Views: 1690 		1518076800 1690
Description:
Author: QAtester3
Session Name: !@!$(GSDFG
Genome Assembly: galGal6
Creation Date: 2019-01-22
Views: 1753 		1548144000 1753
Description: This session of gene prediction tracks for "heart genes" uses the interact and bigGenePred formats to create decorations and the image of a heart. Read more about the interact format and bigGenePred formats from links on the Data File Formats help page under the Help menu and FAQs: http://genome.ucsc.edu/FAQ/FAQformat.html
Author: PublicSessions
Session Name: heart
Genome Assembly: hg38
Creation Date: 2019-02-11
Views: 4407 		1549872000 4407
Description:
Author: PublicSessions
Session Name: Tabula_muris
Genome Assembly: mm10
Creation Date: 2019-04-05
Views: 1772 		1554451200 1772
Description:
Author: cook2wj
Session Name: Alpha Syn Chip Data
Genome Assembly: hg18
Creation Date: 2016-07-22
Views: 1915 		1469174400 1915
Description:
Author: matthew.law
Session Name: MTAP_melanoma
Genome Assembly: hg19
Creation Date: 2016-07-25
Views: 2050 		1469433600 2050
Description:
Author: lesevimx
Session Name: Alpha Syn Chip Data
Genome Assembly: hg18
Creation Date: 2016-07-21
Views: 1970 		1469088000 1970
Description:
Author: jpate2
Session Name: CGEMS Yeast TRJP primers test
Genome Assembly: sacCer3
Creation Date: 2016-07-21
Views: 2228 		1469088000 2228
Description:
Author: hadani81
Session Name: CGEMS Mouse HD/MC/JD Test
Genome Assembly: mm9
Creation Date: 2016-07-21
Views: 1837 		1469088000 1837
Description:
Author: Nithesh
Session Name: CGEMS Yeast NPC test
Genome Assembly: sacCer3
Creation Date: 2016-07-21
Views: 1932 		1469088000 1932
Description:
Author: monroejd
Session Name: CGEMS Yeast JM
Genome Assembly: sacCer3
Creation Date: 2016-07-21
Views: 1873 		1469088000 1873
Description:
Author: jpate2
Session Name: CGEMS Yeast TRJP test
Genome Assembly: sacCer3
Creation Date: 2016-07-21
Views: 1904 		1469088000 1904
Description:
Author: kapsakcj
Session Name: CGEMS Mouse CK test
Genome Assembly: mm9
Creation Date: 2016-07-21
Views: 1839 		1469088000 1839
Description:
Author: Shockwing
Session Name: CGEMS Yeast (Shockwing) Test
Genome Assembly: sacCer3
Creation Date: 2016-07-21
Views: 2101 		1469088000 2101
Description:
Author: herrsp
Session Name: CGEMS Yeast SPH test
Genome Assembly: sacCer3
Creation Date: 2016-07-21
Views: 1902 		1469088000 1902
Description:
Author: blossta
Session Name: CGEMS Worm TB test
Genome Assembly: ce11
Creation Date: 2016-07-21
Views: 1955 		1469088000 1955
Description:
Author: shufengliu
Session Name: CGEMS Human SL test
Genome Assembly: hg38
Creation Date: 2016-07-21
Views: 2150 		1469088000 2150
Description:
Author: klj002
Session Name: CGEMS Worm (KLJ SFB) test
Genome Assembly: ce11
Creation Date: 2016-07-21
Views: 1886 		1469088000 1886
Description:
Author: MaxHenderson
Session Name: CGEMS Yeast MEH test
Genome Assembly: sacCer3
Creation Date: 2016-07-21
Views: 1945 		1469088000 1945
Description:
Author: cook2wj
Session Name: CGEMS Human WCSK test
Genome Assembly: hg38
Creation Date: 2016-07-21
Views: 1868 		1469088000 1868
Description:
Author: bravonja
Session Name: CGEMS Human JBSP test
Genome Assembly: hg38
Creation Date: 2016-07-21
Views: 1922 		1469088000 1922
Description:
Author: stjacqrm
Session Name: CGEMS Yeast RMSJ test
Genome Assembly: sacCer3
Creation Date: 2016-07-21
Views: 1937 		1469088000 1937
Description:
Author: s.jurg96
Session Name: CGEMS worm SJ EA CG test
Genome Assembly: ce11
Creation Date: 2016-07-21
Views: 1862 		1469088000 1862
Description:
Author: youngbh
Session Name: CGEMS Mouse BHY Custom Tracks Chr6
Genome Assembly: mm9
Creation Date: 2016-07-21
Views: 1944 		1469088000 1944
Description:
Author: youngbh
Session Name: CGEMS Mouse BHY test
Genome Assembly: mm9
Creation Date: 2016-07-21
Views: 2127 		1469088000 2127
Description:
Author: youngbh
Session Name: CGEMS Human BHY test
Genome Assembly: hg38
Creation Date: 2016-07-21
Views: 2008 		1469088000 2008
Description:
Author: youngbh
Session Name: CGEMS Worm BHY test
Genome Assembly: ce11
Creation Date: 2016-07-21
Views: 1894 		1469088000 1894
Description:
Author: dtautz
Session Name: wildmouse
Genome Assembly: mm10
Creation Date: 2016-07-26
Views: 2911 		1469520000 2911
Description:
Author: youngbh
Session Name: CGEMS Yeast BHY test
Genome Assembly: sacCer3
Creation Date: 2016-07-20
Views: 1940 		1469001600 1940
Description:
Author: arem
Session Name: colon methylation
Genome Assembly: hg19
Creation Date: 2019-03-06
Views: 1614 		1551859200 1614
Screenshot not available
Click Here to view
 Description:
Author: Courtney Stout
Session Name: CGems Yeast AH test
Genome Assembly: sacCer3
Creation Date: 2016-07-19
Views: 1958 		1468915200 1958
Description:
Author: MWVermunt
Session Name: H3K27ac Human Brain, Vermunt et al (2014) Cell Reports
Genome Assembly: hg19
Creation Date: 2016-07-13
Views: 2205 		1468396800 2205
Description:
Author: pliu
Session Name: PRAM_master_set
Genome Assembly: hg38
Creation Date: 2019-01-04
Views: 1906 		1546588800 1906
Description:
Author: sajjeev
Session Name: comic sj15_22
Genome Assembly: hg19
Creation Date: 2019-01-04
Views: 1674 		1546588800 1674
Description:
Author: lijin
Session Name: session7 97L 3 chip
Genome Assembly: hg19
Creation Date: 2016-06-20
Views: 2176 		1466409600 2176
Description: This session displays the locations of significant SNPs from the GWAS for breast cancer DFS with P < 1 x 10-5 and eQTL-SNPs from GTEx portal with P < 1 × 10–10.
Author: Wen-Cheng
Session Name: rs1024176
Genome Assembly: hg19
Creation Date: 2018-05-25
Views: 1645 		1527235200 1645
Description: This session demonstrates the GTEx track on the human assembly hg19. The GTEx track shows data from the NIH Genotype-Tissue Expression project and displays expression data for each gene, based on GENCODE gene models, from 51 tissues collected from 570 individual. This session also demonstrates the gene-only mode of the multi-region feature, which removes intergenic regions from the display.
Author: mspeir
Session Name: hg19_gtexAnnouncement
Genome Assembly: hg19
Creation Date: 2016-06-17
Views: 2056 		1466150400 2056
Description: This session is demonstrating the exon-only mode of the multi-region feature. The exon-only mode uses the GENCODE v22 track to slice up the normal display and remove both intronic and intergenic regions from the display. Only those regions covered by exons, both coding and noncoding, are left in the display. For more on the multi-region display see the user guide: http://genome.ucsc.edu/goldenPath/help/multiRegionHelp.html.
Author: mspeir
Session Name: hg38_exonOnlyExample
Genome Assembly: hg38
Creation Date: 2016-06-17
Views: 1937 		1466150400 1937
Description:
Author: mspeir
Session Name: hg19_CAGrepeat
Genome Assembly: hg19
Creation Date: 2016-06-17
Views: 2014 		1466150400 2014
Description: Public session showcasing the GTEx gene expression track and GTEx RNA-seq signal hub for the <a target=_blank href='http://genome.ucsc.edu/blog/gtex-resources-in-the-browser/'>GTEx Resources in the Browser</a> GB blog article. The session shows a genomic region with 5 genes with different patterns of tissue-specific expression.
Author: kate
Session Name: GTEx demo for blog (long, with error)
Genome Assembly: hg19
Creation Date: 2016-06-09
Views: 4580 		1465459200 4580
Description: This track also features a new (2016) gene expression display method that extends the traditional Genome Browser display — a horizontal bar graph. Every gene is annotated by a graph with colored bars, each of which corresponds to a specific tissue assayed by the GTEx project. Within a graph, the bar color indicates the tissue type, using GTEx conventions, and the bar height depicts the median expression level (in RPKM).To quickly view the tissue and expression level represented by a bar in the tracks display, mouse over the bar in the graph. The complete tissue color legend is shown on the track configuration page, and can also be popped up for viewing alongside the track using the right-click menu. Below the bar graph, a line is shown indicating the gene extent that was used to generate the annotation, colored by gene class using GENCODE conventions (e.g. blue for protein-coding, green for non-coding).
Author: brianlee
Session Name: hg19.GTEx
Genome Assembly: hg19
Creation Date: 2016-06-06
Views: 577 		1465200000 577
Description:
Author: ruhollah
Session Name: hg19_681_chr15_nmtf13
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1721 		1554105600 1721
Description: Session highlights a mouse-specific repeat on chromosome 12. You can see the gap in the 60-way vertebrate alignment surrounding the repeat, which is highlighted in light blue. The repeat is classified as a LINE and is part of the L1 family of repeats. Additionally, on the far right-hand side of the display, you can see the retrotransposed Bf3 gene.
Author: mspeir
Session Name: mm10_MouseSpecificRepeat_plus_RetroposedGene
Genome Assembly: mm10
Creation Date: 2016-05-24
Views: 1833 		1464076800 1833
Description: Session displays the promoter region of DARC on human assembly hg19 including UCSC Genes, dbSNP 146 (Common subset) and the Publications track showing sequences and SNPs text-mined from PubMed Central and Elsevier. Adapted from Figure 1 in Meyer, et al. The UCSC Genome Browser database: extensions and updates 2013. Nucleic Acids Res. 2013 Jan;41(Database issue):D64-9: http://nar.oxfordjournals.org/content/41/D1/D64.long.
Author: mspeir
Session Name: hg19_NAR_2013_Fig1
Genome Assembly: hg19
Creation Date: 2016-05-24
Views: 2012 		1464076800 2012
Description: Session displays the dyskeratosis congenita 1 (DKC1) gene using the exon-only multi-region mode in the human assembly hg38. Alongside the gene structure, tracks displaying dbSNP "flagged" variants, OMIM clinical variants, ENCODE transcription levels from 9 cell lines, a 100-way vertebrate alignment (only a subset of species displayed), and conservation scores calculated using phyloP across this 100-way alignment.
Author: mspeir
Session Name: hg38_DKC1_SNPs_Cons_Transcription
Genome Assembly: hg38
Creation Date: 2016-05-24
Views: 1951 		1464076800 1951
Description: Session displays the promoter region and transcription start of IRF1 on human assembly hg19 showing UCSC Genes, 1000 Genomes Phase 3 Integrated Variant Calls in the haplotype sorting VCF display mode, histone mark H3K27Ac binding in overlays of 7 ENCODE cell lines and PhyloP conservation scores from alignments of 100 vertebrates. Adapted from Figure 2 in Meyer, et al. The UCSC Genome Browser database: extensions and updates 2013. Nucleic Acids Res. 2013 Jan;41(Database issue):D64-9: http://nar.oxfordjournals.org/content/41/D1/D64.long.
Author: mspeir
Session Name: hg19_NAR_2013_Fig2
Genome Assembly: hg19
Creation Date: 2016-05-24
Views: 2083 		1464076800 2083
Description:
Author: as00419
Session Name: hg38
Genome Assembly: hg38
Creation Date: 2019-05-09
Views: 1641 		1557388800 1641
Description:
Author: lijin
Session Name: session2 four types
Genome Assembly: hg19
Creation Date: 2016-04-17
Views: 2690 		1460880000 2690
Description:
Author: lijin
Session Name: session5 whole genome methy
Genome Assembly: hg19
Creation Date: 2016-04-29
Views: 2054 		1461916800 2054
Description:
Author: leipinji
Session Name: hg19-HCT116-liyiming
Genome Assembly: hg19
Creation Date: 2016-04-12
Views: 1836 		1460448000 1836
Description:
Author: Julia H-Z
Session Name: Cancer Cell Tracks
Genome Assembly: hg19
Creation Date: 2019-02-19
Views: 1660 		1550563200 1660
Description:
Author: Julia H-Z
Session Name: CC Tracks 2
Genome Assembly: hg19
Creation Date: 2019-02-20
Views: 1603 		1550649600 1603
Description:
Author: jdf228
Session Name: PGC-1 alpha ChIP-seq C2C12
Genome Assembly: mm9
Creation Date: 2017-03-20
Views: 2074 		1489996800 2074
Description:
Author: gunasekaran
Session Name: Gunasekaran_Dhandapani_UCSC_mm10
Genome Assembly: mm10
Creation Date: 2019-02-07
Views: 1573 		1549526400 1573
Description:
Author: ascendgene
Session Name: 60genes panel chr1
Genome Assembly: hg19
Creation Date: 2018-07-25
Views: 1974 		1532505600 1974
Description:
Author: peijinlim
Session Name: mm9 nrf2chipseq tracks
Genome Assembly: mm9
Creation Date: 2016-10-19
Views: 1956 		1476864000 1956
Description:
Author: SCRB20
Session Name: SCRB20_GOOD
Genome Assembly: hg19
Creation Date: 2016-03-21
Views: 1819 		1458547200 1819
Description:
Author: msantos.13
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2019-02-06
Views: 1588 		1549440000 1588
Description:
Author: janzop
Session Name: mm9_HBx-RFP
Genome Assembly: mm9
Creation Date: 2016-09-27
Views: 1794 		1474963200 1794
Description:
Author: lijin
Session Name: session1 Liver 97L exp meth
Genome Assembly: hg19
Creation Date: 2016-04-17
Views: 2018 		1460880000 2018
Description:
Author: labrozam
Session Name: mm9
Genome Assembly: mm9
Creation Date: 2016-10-02
Views: 2410 		1475395200 2410
Description:
Author: wenzelmk
Session Name: BIO 481 hg38 CHR2 Chimp Assignement
Genome Assembly: hg38
Creation Date: 2017-10-10
Views: 1698 		1507622400 1698
Description:
Author: kianoush
Session Name: Panels
Genome Assembly: hg19
Creation Date: 2019-03-06
Views: 1404 		1551859200 1404
Description:
Author: arem
Session Name: hg19_chr10_Human
Genome Assembly: hg19
Creation Date: 2019-03-08
Views: 1584 		1552032000 1584
Description:
Author: ephong0305
Session Name: KSG GWAS IA chr1_22 v1
Genome Assembly: hg19
Creation Date: 2021-07-30
Views: 1227 		1627632000 1227
Description:
Author: dunlapea
Session Name: Dunlap, BIO480 Uba1 example
Genome Assembly: hg19
Creation Date: 2016-09-04
Views: 1992 		1472976000 1992
Description:
Author: cocopow
Session Name: hg19epigenetics_WASHU_VizHub
Genome Assembly: hg19
Creation Date: 2019-02-07
Views: 1666 		1549526400 1666
Description:
Author: harri5al
Session Name: CGEMS yeast (AH) test
Genome Assembly: sacCer3
Creation Date: 2018-01-08
Views: 1940 		1515398400 1940
Description:
Author: anneabraham1
Session Name: Spring18 Yeast test Abraham
Genome Assembly: sacCer3
Creation Date: 2018-01-08
Views: 1744 		1515398400 1744
Description:
Author: nedaronaghi
Session Name: hg19-all_weeks
Genome Assembly: hg19
Creation Date: 2017-03-07
Views: 1947 		1488873600 1947
Description:
Author: Natedawg34
Session Name: fall17 bio630 human NM
Genome Assembly: hg38
Creation Date: 2017-09-13
Views: 1748 		1505289600 1748
Description:
Author: Natedawg34
Session Name: Fall 2017 Bio 630 NM
Genome Assembly: hg38
Creation Date: 2017-09-13
Views: 1691 		1505289600 1691
Description:
Author: stjacqrm
Session Name: Fall17 Bio630 Yeast RMSJ test
Genome Assembly: sacCer3
Creation Date: 2017-09-13
Views: 1724 		1505289600 1724
Description:
Author: alexc
Session Name: MitoGenome Analysis
Genome Assembly: hg38
Creation Date: 2016-05-17
Views: 1815 		1463472000 1815
Description:
Author: Natedawg34
Session Name: Miller, Fall17, Uba1
Genome Assembly: mm10
Creation Date: 2017-09-12
Views: 1778 		1505203200 1778
Description:
Author: alexc
Session Name: ARUP_cyto
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 2249 		1543219200 2249
Description: chr2
Author: diazacex
Session Name: Chimp
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 231 		1726560000 231
Description:
Author: leipinji
Session Name: hg19-HCT16-H3K27ac-P53-EP300
Genome Assembly: hg19
Creation Date: 2015-10-22
Views: 1918 		1445500800 1918
Description:
Author: hfw824
Session Name: Dou_LADs IgHV
Genome Assembly: hg19
Creation Date: 2015-10-20
Views: 2099 		1445328000 2099
Description:
Author: delphine.rolando10
Session Name: hg19_HI-LNCs_UCSCsession
Genome Assembly: hg19
Creation Date: 2016-11-01
Views: 2004 		1477987200 2004
Screenshot not available
Click Here to view
 Description:
Author: wentao li
Session Name: 2CPD and 64 NT2
Genome Assembly: hg19
Creation Date: 2015-10-06
Views: 1779 		1444118400 1779
Description:
Author: leipinji
Session Name: hg19-hct116-LYM-RNASeq
Genome Assembly: hg19
Creation Date: 2017-10-05
Views: 1955 		1507190400 1955
Description:
Author: lianeslaughter
Session Name: mm9-H4K16acRestored
Genome Assembly: mm9
Creation Date: 2017-09-26
Views: 2242 		1506412800 2242
Description:
Author: robert-cornell@uiowa.edu
Session Name: evo mels hg19 TFAP2A in hNCC
Genome Assembly: hg19
Creation Date: 2014-05-29
Views: 1515 		1401350400 1515
Description:
Author: GenePeeks
Session Name: .2017.10 Haplotype & HGDP
Genome Assembly: hg19
Creation Date: 2017-10-06
Views: 2092 		1507276800 2092
Screenshot not available
Click Here to view
 Description:
Author: jcasper
Session Name: bedtoolsvssamtools
Genome Assembly: hg18
Creation Date: 2014-05-27
Views: 2009 		1401177600 2009
Description:
Author: jverploegen
Session Name: GHE sequencing steroids
Genome Assembly: hg19
Creation Date: 2017-10-10
Views: 1904 		1507622400 1904
Description:
Author: hs523
Session Name: mm10-ZFP57-SentToAnastasia-merged
Genome Assembly: mm10
Creation Date: 2016-01-13
Views: 2055 		1452672000 2055
Description:
Author: GenePeeks
Session Name: .2017 Zoomed-in View 1
Genome Assembly: hg19
Creation Date: 2017-10-09
Views: 1698 		1507536000 1698
Description:
Author: taly
Session Name: EnhancerPrediction
Genome Assembly: dm3
Creation Date: 2017-10-10
Views: 1865 		1507622400 1865
Description:
Author: rhead
Session Name: 450k.EPIC.beadchip
Genome Assembly: hg19
Creation Date: 2016-11-06
Views: 2090 		1478419200 2090
Description: This mailing question allows one to see how you can color the current DNA with data from tracks such as SNP tracks. Load the session, then type "v d" or go to the View menu and then select DNA.<br> Once you are on the "Get DNA for" page do not click "get DNA" rather click the <b>'extended case/color options'</b> button and get Extended DNA Case/Color Output with DNA colored per the SNP tracks (150 in this case) or choose other tracks. <b>Note</b> that the All SNPs are Italic and Blue and the Common SNPs are Bold and Red and when they are both the colors and style combine.
Author: brianlee
Session Name: hg19.MLQ_20306
Genome Assembly: hg19
Creation Date: 2017-10-11
Views: 1864 		1507708800 1864
Description:
Author: robert-cornell@uiowa.edu
Session Name: eliz leslie hg19
Genome Assembly: hg19
Creation Date: 2014-01-17
Views: 1506 		1389945600 1506
Description: This is a session with some highlights.
Author: brianlee
Session Name: moreHighlights
Genome Assembly: hg38
Creation Date: 2019-05-07
Views: 1551 		1557216000 1551
Description:
Author: josoga2
Session Name: chromHmm
Genome Assembly: hg19
Creation Date: 2020-06-09
Views: 1470 		1591689600 1470
Description: nar
Author: as00419
Session Name: example
Genome Assembly: hg38
Creation Date: 2019-05-09
Views: 1616 		1557388800 1616
Description:
Author: ccpowell
Session Name: 50120_solLyc1
Genome Assembly: hub_2224691_solLyc1
Creation Date: 2020-05-07
Views: 1409 		1588838400 1409
Description:
Author: bashamal
Session Name: hg38 chr2 comparison 10/10 in class
Genome Assembly: hg38
Creation Date: 2017-10-10
Views: 1786 		1507622400 1786
Description:
Author: estercastillo
Session Name: VanesaGarcia_ClinicoSanCarlos_hotspots_131686
Genome Assembly: hg19
Creation Date: 2017-10-19
Views: 1795 		1508400000 1795
Description:
Author: cocopow
Session Name: hg18_44way_bed
Genome Assembly: hg18
Creation Date: 2019-07-24
Views: 1475 		1563955200 1475
Description:
Author: wenzelmk
Session Name: BIO481 Mouse (Wenzel & Zeher) test
Genome Assembly: mm9
Creation Date: 2017-10-05
Views: 1630 		1507190400 1630
Description:
Author: macdonem
Session Name: Bio481 Mouse MacDonald Basham Test
Genome Assembly: mm9
Creation Date: 2017-10-05
Views: 1711 		1507190400 1711
Description:
Author: herdaj
Session Name: Bio481 Human Herd Test
Genome Assembly: hg38
Creation Date: 2017-10-05
Views: 1877 		1507190400 1877
Description:
Author: labrozam
Session Name: Bio481 Human Labrozzi-Grant test
Genome Assembly: hg38
Creation Date: 2017-10-05
Views: 1731 		1507190400 1731
Description:
Author: XiangChen
Session Name: Bio481 Yeast Chen Test
Genome Assembly: sacCer3
Creation Date: 2017-10-05
Views: 1736 		1507190400 1736
Description: This session shows the Integrative and Discriminative Epigenome Annotation System (IDEAS) Public Hub, which has data for inferred chromatin states in 127 cell types. A color key for each state is shown near a heatmap on the Track Description page, also found in the related journal <a href="https://academic.oup.com/view-large/figure/97265435/gkx659fig1.jpg/Accurate%20and%20reproducible%20functional%20maps%20in%20127%20human%20cell%20types%20via%202D%20genome%20segmentation">figure 1</a>. This session has some segmentation examples by IDEAS and ChromHMM in HSC and B-cell cell types (9 total) near genes CIITA and CLEC16A. Find more reference information on the Track Description page or at this <a href="https://doi.org/10.1093/nar/gkx659">journal article</a>. The IDEAS algorithm is available on GitHub at <a href="https://github.com/yuzhang123/IDEAS">https://github.com/yuzhang123/IDEAS</a>.
Author: brianlee
Session Name: hg19.IDEAS.hub
Genome Assembly: hg19
Creation Date: 2017-10-05
Views: 2232 		1507190400 2232
Description:
Author: estercastillo
Session Name: VanesaGarcia_ClinicoSanCarlos_Pancreas_131774
Genome Assembly: hg19
Creation Date: 2017-10-22
Views: 1786 		1508659200 1786
Description:
Author: hujian5241
Session Name: fly_dh1_dm3_bw
Genome Assembly: dm3
Creation Date: 2017-11-13
Views: 1751 		1510560000 1751
Description:
Author: simonwang612
Session Name: Methylation
Genome Assembly: mm10
Creation Date: 2020-07-25
Views: 1880 		1595664000 1880
Description:
Author: anneabraham1
Session Name: Abraham, Spring18, Uba1 example
Genome Assembly: mm9
Creation Date: 2018-01-13
Views: 1942 		1515830400 1942
Description:
Author: robert-cornell@uiowa.edu
Session Name: Ruchi tracks hg19
Genome Assembly: hg19
Creation Date: 2014-01-27
Views: 1505 		1390809600 1505
Description:
Author: twx123
Session Name: PTC-mm9-newest
Genome Assembly: mm9
Creation Date: 2015-06-10
Views: 1612 		1433923200 1612
Description:
Author: cocopow
Session Name: hg38_chr17_KCNJ18
Genome Assembly: hg38
Creation Date: 2019-03-07
Views: 1771 		1551945600 1771
Description:
Author: robert-cornell@uiowa.edu
Session Name: mm9 visel enhancers
Genome Assembly: mm9
Creation Date: 2014-01-11
Views: 1582 		1389427200 1582
Description:
Author: Shirley
Session Name: WT-RNA-ribo-seq
Genome Assembly: mm10
Creation Date: 2018-11-20
Views: 1476 		1542700800 1476
Description:
Author: QAtester
Session Name: 111hg38
Genome Assembly: hg38
Creation Date: 2018-12-21
Views: 1987 		1545379200 1987
Description:
Author: Boonede
Session Name: MAPT_DougBoone
Genome Assembly: hg38
Creation Date: 2019-03-11
Views: 1615 		1552291200 1615
Description:
Author: Guillermo6
Session Name: hg19_ashg2014_SNPs
Genome Assembly: hg19
Creation Date: 2017-11-01
Views: 1910 		1509523200 1910
Description:
Author: ferhatay
Session Name: hg19
Genome Assembly: hg19
Creation Date: 2016-08-25
Views: 1898 		1472112000 1898
Description:
Author: kkarri
Session Name: rn6_transcriptome
Genome Assembly: rn6
Creation Date: 2017-10-27
Views: 1878 		1509091200 1878
Description:
Author: wangt5
Session Name: HBEC_VitD
Genome Assembly: hg19
Creation Date: 2017-11-15
Views: 1723 		1510732800 1723
Description:
Author: bashamal
Session Name: Basham, Fall17, Uba1 example
Genome Assembly: mm9
Creation Date: 2017-10-02
Views: 1805 		1506931200 1805
Description:
Author: cocapo
Session Name: ponAbe3_BTN1A1
Genome Assembly: ponAbe3
Creation Date: 2018-11-15
Views: 1869 		1542268800 1869
Description:
Author: lbenner
Session Name: Sxl
Genome Assembly: dm6
Creation Date: 2016-10-22
Views: 2136 		1477123200 2136
Description: Before alignments, lineage-specific repeats (LSRs) are removed, not masked, from the sequences -- thus the sequences become shorter. This process is in effect pretending that no new repeat insertions happened since the most recent common ancestor. By taking this step, it helps the aligner to extend an alignment further along the diverged sequences, when otherwise a repeat insertion in one lineage would have broken the alignment. However, with this step the sequence coordinates returned by the aligner are now for artificially shortened sequences. The resulting alignments' coordinates are adjusted back to original sequence coords by PSU's restore_rpts script. Where an alignment extended across an excised repeat, it now gets a gap as it hops over the restored repeat.
Author: brianlee
Session Name: mm10.MLQ12129.Ex2
Genome Assembly: mm10
Creation Date: 2013-11-08
Views: 38 		1383897600 38
Description:
Author: macdonem
Session Name: Old AMD SNPs
Genome Assembly: hg38
Creation Date: 2017-10-31
Views: 1761 		1509436800 1761
Description:
Author: macdonem
Session Name: New AMD SNPs
Genome Assembly: hg38
Creation Date: 2017-10-31
Views: 1746 		1509436800 1746
Description:
Author: falbert
Session Name: FP_sacCer3
Genome Assembly: sacCer3
Creation Date: 2013-08-07
Views: 1767 		1375862400 1767
Description:
Author: ruhollah
Session Name: hg19_94Chr12_28
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1760 		1543219200 1760
Description: EEPD1 ChIP-seq on chromosome 1 hg38
Author: abacolla
Session Name: eepd1_chr1
Genome Assembly: hg38
Creation Date: 2023-05-30
Views: 562 		1685433600 562
Description:
Author: cocopow
Session Name: hg38_ RepeatMasker
Genome Assembly: hg38
Creation Date: 2019-01-24
Views: 1699 		1548316800 1699
Description:
Author: kkaczor
Session Name: cirm_ucla
Genome Assembly: hg38
Creation Date: 2020-11-12
Views: 1382 		1605168000 1382
Description:
Author: cocopow
Session Name: hg38_tf _pc
Genome Assembly: hg38
Creation Date: 2019-06-11
Views: 1507 		1560240000 1507
Description:
Author: cocopow
Session Name: hg38_tf_pc2
Genome Assembly: hg38
Creation Date: 2019-06-11
Views: 1472 		1560240000 1472
Description:
Author: cocopow
Session Name: hg19_myc+ctcf
Genome Assembly: hg19
Creation Date: 2019-06-11
Views: 1630 		1560240000 1630
Description:
Author: cocopow
Session Name: hg38_myc+ctcf
Genome Assembly: hg38
Creation Date: 2019-06-11
Views: 1631 		1560240000 1631
Description:
Author: dtautz
Session Name: wildmouse-introgression
Genome Assembly: mm10
Creation Date: 2017-11-04
Views: 1836 		1509782400 1836
Description:
Author: lijin
Session Name: session4 plus h3k27ac density andpeaks
Genome Assembly: hg19
Creation Date: 2016-04-28
Views: 1936 		1461830400 1936
Description:
Author: lijin
Session Name: session3 plus h3k27ac
Genome Assembly: hg19
Creation Date: 2016-04-28
Views: 2000 		1461830400 2000
Description:
Author: XiangChen
Session Name: Bio481 Yeast Chen Custom Track
Genome Assembly: sacCer3
Creation Date: 2017-10-17
Views: 1846 		1508227200 1846
Description:
Author: XiangChen
Session Name: Bio481 Chen Gzmm CBRs in Mice Photoreceptors
Genome Assembly: mm9
Creation Date: 2017-11-17
Views: 1678 		1510905600 1678
Description: This session illustrates how a user was having a hard time aligning the cDNA sequence with their Predicted Protein. They were manually using DNA sequence to make a triplet number to figure out codon numbering. The session shows how when zoomed in on the base level, if you right click the top Base Position track and set it to display in "full" you will see predicted proteins for every set of codons across the genome. This particular session at the start of the SIRT1 gene is also displaying the conservation tracks with similar coding information for several species. This information is also available in the table browser, where you can select output as "sequence" for a genomic region when you select a gene's track table as the source.
Author: brianlee
Session Name: exampleProteinGene
Genome Assembly: hg19
Creation Date: 2013-08-23
Views: 477 		1377244800 477
Description: For_RECOGNICER_SICER_peak_comparison_120121
Author: ankurucsc
Session Name: For_RECOGNICER_SICER_peak_comparison_120121
Genome Assembly: mm10
Creation Date: 2021-01-11
Views: 25 		1610352000 25
Description: HBB on hg38 with single cell Heart and Merged data
Author: ashg2023
Session Name: hg38_HBB_singleCell1
Genome Assembly: hg38
Creation Date: 2023-08-03
Views: 470 		1691049600 470
Description: Hemoglobin beta 3 isoforms displayed, snp155 Common turned on.
Author: ashg2023
Session Name: hg38_HBB_snp155
Genome Assembly: hg38
Creation Date: 2023-08-03
Views: 472 		1691049600 472
Description:
Author: jwjiao
Session Name: E13-forebrain-H3K36me3-ChIP
Genome Assembly: mm10
Creation Date: 2017-11-06
Views: 2014 		1509955200 2014
Description:
Author: ruhollah
Session Name: hg19_45Chr3_nmt10
Genome Assembly: hg19
Creation Date: 2018-11-27
Views: 1597 		1543305600 1597
Description:
Author: ruhollah
Session Name: hg19_56Chr19_nmt10
Genome Assembly: hg19
Creation Date: 2018-11-27
Views: 1568 		1543305600 1568
Description:
Author: isilver1
Session Name: PABPC1_CLIP_Public
Genome Assembly: mm10
Creation Date: 2015-07-01
Views: 2613 		1435737600 2613
Description:
Author: xiaotiao
Session Name: 4CProject
Genome Assembly: hg38
Creation Date: 2019-03-15
Views: 1528 		1552636800 1528
Description:
Author: zhangjing12
Session Name: 201901-ATAC seq
Genome Assembly: hg38
Creation Date: 2019-03-15
Views: 1590 		1552636800 1590
Description: human chr.2 synteny to other primates
Author: marte2je
Session Name: hg38 to other primates - chr2
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 227 		1726560000 227
Description: 9/17/24
Author: aehodges
Session Name: hg38 chromosome 2/Chimp
Genome Assembly: hg38
Creation Date: 2024-09-17
Views: 219 		1726560000 219
Description:
Author: hujian5241
Session Name: fly_dh1_dm3
Genome Assembly: dm3
Creation Date: 2017-11-12
Views: 1705 		1510473600 1705
Description:
Author: salima
Session Name: e32_tailseq_5p_3p
Genome Assembly: ce10
Creation Date: 2015-07-03
Views: 2255 		1435910400 2255
Description: This session was used to answer a mailing list question about mm9.retina data. You can see how the signal data was processed to create finalized peaks.
Author: brianlee
Session Name: mm9.retina
Genome Assembly: mm9
Creation Date: 2017-11-14
Views: 1741 		1510646400 1741
Description:
Author: keitermd
Session Name: Keiter, Spring 2017, Uba1 example
Genome Assembly: mm9
Creation Date: 2017-01-15
Views: 1827 		1484467200 1827
Description:
Author: aurbanow
Session Name: srivatsan
Genome Assembly: hg38
Creation Date: 2020-12-28
Views: 1530 		1609142400 1530
Description:
Author: nicklewis
Session Name: photoreceptor sesh
Genome Assembly: mm9
Creation Date: 2017-11-16
Views: 1815 		1510819200 1815
Description:
Author: nicklewis
Session Name: photorecptor session
Genome Assembly: mm9
Creation Date: 2017-11-16
Views: 1753 		1510819200 1753
Description:
Author: nrhong
Session Name: hg38_KIAA1217
Genome Assembly: hg38
Creation Date: 2018-01-25
Views: 1759 		1516867200 1759
Description:
Author: labrozam
Session Name: wt/Nrl-
Genome Assembly: mm9
Creation Date: 2017-11-17
Views: 1751 		1510905600 1751
Description:
Author: german.n
Session Name: zebrafish_Iso-Seq
Genome Assembly: danRer10
Creation Date: 2018-03-16
Views: 1772 		1521187200 1772
Description:
Author: ruhollah
Session Name: hg19_1220_chr3_nmtf13
Genome Assembly: hg19
Creation Date: 2019-04-01
Views: 1736 		1554105600 1736
Description:
Author: Yog77
Session Name: chrMT_rCRS_NC012920
Genome Assembly: hg19
Creation Date: 2020-05-20
Views: 1377 		1589961600 1377
Description:
Author: timmnat
Session Name: Figure4-Differences_in_polymorphism_frequency_and_copy number.hub_1106737_Amex_PQ.v4
Genome Assembly: hub_1106737_Amex_PQ.v4
Creation Date: 2020-09-13
Views: 1754 		1599984000 1754
Description:
Author: robert-cornell@uiowa.edu
Session Name: mm9 Loftus/Pavan Tfap2a
Genome Assembly: mm9
Creation Date: 2014-06-23
Views: 1487 		1403510400 1487
Description:
Author: robert-cornell@uiowa.edu
Session Name: tfap2a in Ncc, MITF hg18
Genome Assembly: hg18
Creation Date: 2014-09-30
Views: 1589 		1412064000 1589
Description:
Author: grant2jm
Session Name: Grant, Fall 17, allignment example
Genome Assembly: hg38
Creation Date: 2017-10-09
Views: 1763 		1507536000 1763
Description:
Author: katiegal
Session Name: Lhx3-Isl1-p53
Genome Assembly: mm9
Creation Date: 2014-10-01
Views: 1412 		1412150400 1412
Description:
Author: mattievaz8
Session Name: 062816_Mattie
Genome Assembly: mm10
Creation Date: 2016-06-28
Views: 1967 		1467100800 1967
Description:
Author: nicklewis
Session Name: Lewis Fall17 Uba1
Genome Assembly: mm9
Creation Date: 2017-10-03
Views: 1774 		1507017600 1774
Description:
Author: holtonke
Session Name: CGEMS Worm KEH test
Genome Assembly: ce11
Creation Date: 2016-07-21
Views: 1941 		1469088000 1941
Description:
Author: alyssa
Session Name: Ayala-Ps2-ACE2-session
Genome Assembly: hg19
Creation Date: 2020-05-07
Views: 1706 		1588838400 1706
Description:
Author: yierjin_2008
Session Name: MMCL.H3K27ac.SEs
Genome Assembly: hg19
Creation Date: 2017-11-10
Views: 1928 		1510300800 1928
Description:
Author: ruhollah
Session Name: hg19_72Chr14_nmt14
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 2104 		1543219200 2104
Description:
Author: ShiyiYin
Session Name: mega data with coordinations
Genome Assembly: hg19
Creation Date: 2017-02-08
Views: 1973 		1486540800 1973
Description:
Author: ShiyiYin
Session Name: intron6 ehf pcr
Genome Assembly: hg19
Creation Date: 2017-01-27
Views: 1966 		1485504000 1966
Description: This session highlights the "Seq-data on mm9 NS5 cells" public hub, where Juan Mateo et al. assayed crucial transcription factor binding activity forming the basis of the neural stem cell self-renewal regulatory network.
Author: chmalee
Session Name: mm9_NS5_Cell_Expression
Genome Assembly: mm9
Creation Date: 2017-11-28
Views: 2291 		1511856000 2291
Description:
Author: grant2jm
Session Name: Grant, Fall17, Uba1 example
Genome Assembly: mm9
Creation Date: 2017-10-02
Views: 1698 		1506931200 1698
Description:
Author: isilver1
Session Name: NAD
Genome Assembly: mm10
Creation Date: 2015-03-09
Views: 2107 		1425888000 2107
Description:
Author: ruhollah
Session Name: 1_50_outliers_hg19
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1905 		1543219200 1905
Description:
Author: zheyangshan
Session Name: hg19 GRO-seq BCL2
Genome Assembly: hg19
Creation Date: 2019-01-16
Views: 1478 		1547625600 1478
Description:
Author: mspeir
Session Name: hg19_wobble
Genome Assembly: hg19
Creation Date: 2016-06-17
Views: 2549 		1466150400 2549
Description:
Author: toni.berger@medisin.uio.no
Session Name: example1
Genome Assembly: hg19
Creation Date: 2017-11-13
Views: 2084 		1510560000 2084
Description:
Author: puertoRico2019
Session Name: DQP
Genome Assembly: hg19
Creation Date: 2019-04-12
Views: 1449 		1555056000 1449
Description:
Author: mziegler
Session Name: encode_Accessibility+TAD
Genome Assembly: hg19
Creation Date: 2018-09-11
Views: 1628 		1536652800 1628
Description: ENCODE tracks are displayed around the gene TNFAIP3 indicating where DNase activity, Transcription Factor Binding, RNA transcription, and histone modification has been observed.
Author: brianlee
Session Name: hg19.TNFAIP3
Genome Assembly: hg19
Creation Date: 2015-01-05
Views: 167 		1420444800 167
Description:
Author: cath
Session Name: v338test
Genome Assembly: hg38
Creation Date: 2016-09-13
Views: 1880 		1473753600 1880
Description:
Author: josoga2
Session Name: joseph_omix_hw
Genome Assembly: mm10
Creation Date: 2020-05-19
Views: 1363 		1589875200 1363
Description:
Author: macdonem
Session Name: Bio481 Mouse MacDonald Basham Custom Track
Genome Assembly: mm9
Creation Date: 2017-10-17
Views: 1719 		1508227200 1719
Description:
Author: nicklewis
Session Name: CGEMS Yeast Test - Custom Track
Genome Assembly: sacCer3
Creation Date: 2017-10-17
Views: 1729 		1508227200 1729
Description:
Author: herdaj
Session Name: Bio481 Human Custom Herd
Genome Assembly: hg38
Creation Date: 2017-10-17
Views: 1998 		1508227200 1998
Description:
Author: erick.gabriel
Session Name: MYBPC1 alleles
Genome Assembly: hg19
Creation Date: 2018-09-07
Views: 1669 		1536307200 1669
Description: This example session shows some selected cell lines displayed with DNaseI tracks available for the mm9 mouse assembly from the ENCODE project. You can click the grey bars at the far left to go to the track descriptions, and select even more cell types. This session is the result of a user requesting where to find known areas/regions of chromatin in the mouse genome, especially condensed regions of DNA. By entering the user's coordinates of interest the researcher could investigate data indicating hypersensitive DNase regions.
Author: brianlee
Session Name: DNase in mm9 Example
Genome Assembly: mm9
Creation Date: 2013-07-30
Views: 427 		1375171200 427
Description:
Author: ruhollah
Session Name: hg19_209Chr7_nmt4
Genome Assembly: hg19
Creation Date: 2019-01-14
Views: 1596 		1547452800 1596
Description:
Author: marzoldr
Session Name: Marzolf, Spring18, Uba1 example
Genome Assembly: mm9
Creation Date: 2018-01-17
Views: 1684 		1516176000 1684
Description: The GeneHancer track relates enhancer and promoters to their interactions with nearby genes. In this display, a highlighted GH01J209814 enhancer is associated with the gene IRF6 (Interferon Regulatory Factor 6) located about 10kb upstream from the gene and harbors regulatory non-coding variants strongly associated to Van Der Woude Syndrome 1 (VWS1), a disease involving cleft lip and cleft palate.
Author: view
Session Name: GeneHancer
Genome Assembly: hg19
Creation Date: 2019-03-29
Views: 1493 		1553846400 1493
Description:
Author: ferrerjm
Session Name: Ferrer, FALL17, yeast custom track
Genome Assembly: sacCer3
Creation Date: 2017-10-17
Views: 2298 		1508227200 2298
Description: This session displays a region of the LHX6 gene that highlights a selection of the new tracks added in the previous year for the hg38/GRCh38 human assembly. The tracks shown in this display (from top to bottom) include GENCODE Genes V22, transcription levels assayed across 9 ENCODE cell lines, DNase hypersensitive regions based on data from 95 ENCODE cell lines, genome-wide conservation scores calculated using phastCons, a multiple genome alignment created using Lastz and Multiz, and pathogenic CNVs from the ClinGen database. Adapted from Figure 1 in Speir, et al. The UCSC Genome Browser database: 2016 update. Nucleic Acids Res. 2016 Jan 4;44(D1):D717-25: http://nar.oxfordjournals.org/content/44/D1/D717.full
Author: mspeir
Session Name: hg38_NAR_2016_Fig1
Genome Assembly: hg38
Creation Date: 2015-08-11
Views: 2157 		1439280000 2157
Description:
Author: ruhollah
Session Name: hg19_1_chr15
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1730 		1543219200 1730
Description:
Author: ruhollah
Session Name: hg19_4_chr3
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1611 		1543219200 1611
Description:
Author: ruhollah
Session Name: hg19_3_chr14
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1578 		1543219200 1578
Description:
Author: ruhollah
Session Name: hg19_22Chr19_nmt32
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1706 		1543219200 1706
Description:
Author: ruhollah
Session Name: hg19_25Chr5_nmt29
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1547 		1543219200 1547
Description:
Author: ruhollah
Session Name: hg19_69Chr1_nmt29
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1610 		1543219200 1610
Description:
Author: ruhollah
Session Name: hg19_17Chr3_nmt26
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1608 		1543219200 1608
Description:
Author: Atma
Session Name: hervh-MYO16
Genome Assembly: hg38
Creation Date: 2019-01-22
Views: 2073 		1548144000 2073
Description: This browsing started on hg38, and then the region was lifted to hg19, and then the TFBS track turned on to show how some histone activity is related to TFBS that aren't seen on hg38 because the track isn't available there.
Author: brianlee
Session Name: hg19_MTOR
Genome Assembly: hg19
Creation Date: 2019-01-22
Views: 1627 		1548144000 1627
Description:
Author: ruhollah
Session Name: hg19_47Chr14_nmt17
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1571 		1543219200 1571
Description:
Author: ruhollah
Session Name: hg19_55Chr21_nmt19
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1592 		1543219200 1592
Description:
Author: ruhollah
Session Name: hg19_46ChrX_nmt20
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 2149 		1543219200 2149
Description:
Author: ruhollah
Session Name: hg19_31Chr22_nmt20
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1551 		1543219200 1551
Description:
Author: ruhollah
Session Name: hg19_37Chr1_nmt21
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1694 		1543219200 1694
Screenshot not available
Click Here to view
 Description:
Author: ruhollah
Session Name: hg19_18Chr17_21
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1652 		1543219200 1652
Description:
Author: ruhollah
Session Name: hg19_16Chr5_nmt21
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1924 		1543219200 1924
Description:
Author: ruhollah
Session Name: hg19_12Chr3_nmt22
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1664 		1543219200 1664
Description:
Author: ruhollah
Session Name: hg19_95Chr16_nmt17
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1554 		1543219200 1554
Description:
Author: kinerettaler
Session Name: danRer11_plod3+-100,000
Genome Assembly: danRer11
Creation Date: 2018-12-25
Views: 1508 		1545724800 1508
Description:
Author: ruhollah
Session Name: hg19_26Chr17_nmt14
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1563 		1543219200 1563
Description:
Author: xiaotiao
Session Name: txiao
Genome Assembly: hg19
Creation Date: 2019-03-13
Views: 1624 		1552464000 1624
Description:
Author: ruhollah
Session Name: hg19_70Chr6_nmt14
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1743 		1543219200 1743
Description:
Author: ldistefano
Session Name: dm6_LDiStefanoData
Genome Assembly: dm6
Creation Date: 2019-03-12
Views: 1627 		1552377600 1627
Description:
Author: marylaws
Session Name: hg18 Mol Biol Cell 2013 Grant GD
Genome Assembly: hg18
Creation Date: 2017-11-06
Views: 1970 		1509955200 1970
Description: Acinetobacter baumannii ATCC 17978 UN
Author: Ab17978Cook
Session Name: GCF_019356215.1
Genome Assembly: hub_3861787_GCF_019356215.1
Creation Date: 2023-01-12
Views: 521 		1673510400 521
Description:
Author: ruhollah
Session Name: hg19_75Chr7_nmt16
Genome Assembly: hg19
Creation Date: 2018-11-26
Views: 1590 		1543219200 1590
Description:
Author: ruhollah
Session Name: hg19_40Chr22_nmt12
Genome Assembly: hg19
Creation Date: 2018-11-27
Views: 1620 		1543305600 1620
Description:
Author: ruhollah
Session Name: hg19_49Chr3_nmt12
Genome Assembly: hg19
Creation Date: 2018-11-27
Views: 1584 		1543305600 1584
Description:
Author: ruhollah
Session Name: hg19_58Chr1_nmt10
Genome Assembly: hg19
Creation Date: 2018-11-27
Views: 1583 		1543305600 1583
Description:
Author: ruhollah
Session Name: hg19_89Chr5_nmt10
Genome Assembly: hg19
Creation Date: 2018-11-27
Views: 1640 		1543305600 1640
Description:
Author: kazuhidew
Session Name: hg38_NAR_submission
Genome Assembly: hg38
Creation Date: 2018-11-28
Views: 1737 		1543392000 1737